We narrowed to 60,538 results for: Gene
-
-
pUltra-Chili
Plasmid#48687Purpose3rd generation Lentiviral vector with bi-cistronic expression of dtomato and the gene of interest.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Flag TSC2 (S939A/T1462A)
Plasmid#14131DepositorAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
phCMV-coGALVenv-C4070A
Plasmid#172217PurposeExpresses the envelope protein of Gibbon Ape Leukemia Virus (GALV) for pseudotyping of retroviral or lentiviral vectorsDepositorInsertEnvelope protein of Gibbon Ape Leukemia Virus (codon-optimized version)
ExpressionMammalianMutationCarries C-terminus of amphotropic MLV strain 4070…PromoterCMV immediate early promoterAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORI28
Plasmid#71595PurposeEC1000 containing pORI28. Used as the source of plasmid pORI28. With pTRK669, part of a system for chromosomal integration in gram positive bacteria.DepositorTypeEmpty backboneUseIntegration vector for bacteriaAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
-5.5kb-UCP1-GFP
Plasmid#104585PurposeReporter assay to monitor the transcription activity of the UCP1 promoter by GFP expressionDepositorAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-RL-ZEB2
Plasmid#35536DepositorAvailable SinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G1-Km
Plasmid#46813PurposeTEF1 and PGK1 promoter controlled expression cassettes with G418 resistance for yeast transformationDepositorTypeEmpty backboneTagsFLAG and c-mycExpressionYeastPromoterTEF1 and PGK1Available SinceOct. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
PKC epsilon WT
Plasmid#21240DepositorAvailable SinceAug. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Flag-TTGZFP-FokI-DD
Plasmid#18755DepositorInsertzinc finger nuclease
ExpressionBacterialMutationRNA expression vector for expressing the zinc fin…Available SinceJuly 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pZDonor-Nm-Cas9-gRNA-hU6
Plasmid#61366Purposeempty backbone for cloning N. meningiditis protospacers. Encodes constant region of N. meningiditis Cas9 synthetic gRNADepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAMBgfp
Plasmid#206130PurposeThis binary vector has been generated for introduction of SGFP in filamentous fungi using ATMT. Contains the hygromycin resistance gene and the SGFP gene.DepositorInserthygromycin resistance gene and the Promoter of ToxA+SGFP
UseBinary vector for expression of sgfp in filamento…Available SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFRT_TO_DESTFLAGHA
Plasmid#26361DepositorTypeEmpty backboneTagsFLAG/HAExpressionMammalianAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEPT-Acceptor
Plasmid#25648DepositorInsert0
UseAAVExpressionMammalianAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pKNOCK-Cm
Plasmid#46261PurposeBacterial targetingDepositorTypeEmpty backboneUseBacterial targetingAvailable SinceAug. 14, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMo130
Plasmid#27388PurposeBurkholderia allelic exchange suicide vector pMo130, ref EU862243DepositorTypeEmpty backboneUseBurkholderia allelic exchange suicide vector pmo1…Available SinceMarch 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSH100 (YCplac33 MET25pro MCP-mCherry)
Plasmid#45930DepositorInsertMCP-mCherry
TagsmCherryExpressionYeastPromoterMet25Available SinceJuly 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Cre.zf1
Plasmid#61391PurposemRNA synthesis of Cre recombinase codon modified for zebrafishDepositorInsertCre.zf1
UseZebrafish expressionPromotersp6Available SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAR-Ec633
Plasmid#130873PurposeA nuclear plasmid encoding an error-prone mutant TP-DNAP1 (L477V, L640Y, I777K, W814N) for OrthoRepDepositorInsertTP-DNAP1
ExpressionYeastMutationL477V, L640Y, I777K, W814NAvailable SinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag-PML-IV
Plasmid#62804Purposeexpresses the isoform IV of PML (promyelocytic leukemia protein)DepositorAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJFRC12-10XUAS-IVS-myr::GFP
Plasmid#26222DepositorInsertmyr::GFP
ExpressionInsectAvailable SinceOct. 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCIP-AMPKa1_KD
Plasmid#79011PurposeFor mammalian expression of a kinase dead (K47R) version of AMPK alpha1.DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRN227
Plasmid#127222PurposeBeYDV replicon with 35S::Cas9, WUS2 and AtSTM, sgRNA targeting PDSDepositorInsertCas9, WUS2, AtSTM, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-VSVM
Plasmid#64086PurposeExpression vector for Vesicular Stomatitis Virus Indiana strain matrix geneDepositorInsertVSV matrix protein
ExpressionMammalianPromoterCAGAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHygromycin (GB0211)
Plasmid#68204PurposeProvides the CDS of the Hygromycin resistance gene as a level 0 GoldenBraid partDepositorInsertHygromycin resistance gene coding region
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
p133 pSV-STOP-luc
Plasmid#8390DepositorInsertfloxed STOP
UseCre/Lox and LuciferaseExpressionMammalianAvailable SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
pChREBP
Plasmid#39235DepositorAvailable SinceNov. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-p105
Plasmid#23288DepositorInsertp105 (NFKB1 Human)
ExpressionMammalianAvailable SinceApril 29, 2010AvailabilityAcademic Institutions and Nonprofits only
