We narrowed to 16,060 results for: grna
-
Plasmid#64115PurposeVector for expression of Nm sgRNA1.1 in mammalian cellsDepositorInsertNm sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636
Plasmid#43860Purposeguide RNA (gRNA) expression vector used to create a gRNA to a specific sequence, uses U6 promoterDepositorInsertNone
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
psgRNA
Plasmid#114005Purposeexpress sgRNA. ColE1, KanDepositorInsertgRNA
PromoterBBa_J23119Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426-SNR52p-gRNA.csr-1.Y-SUP4t
Plasmid#68060PurposegRNA for csr-1 locus in N. crassaDepositorInsertgRNA for csr-1 locus
UseCRISPR; N. crassa, fungiExpressionYeastPromoterSNR52Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6.3>gRNA.f+e
Plasmid#99139PurposeEmpty gRNA scaffold with "Flip" and "Extension" modifications with optimized chicken specific U6 promoterDepositorInsertgRNA
UseCRISPRPromoterchicken U6.3Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2103
Plasmid#91061PurposeModule B, Promoter: CmYLCV, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterCmYLCVAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB-gRNA-Puro
Plasmid#121121PurposeExpression of a gRNA together with a Puromycin resistanceDepositorInsertgRNA
UseCRISPRExpressionMammalianAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-p15
Plasmid#62656PurposeArabinose inducible lambda red and anhydrotetracycline inducible sgRNA expression that targets pCas9 plasmidDepositorInsertexo, beta, gam, sgRNA
ExpressionBacterialAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
psgRNAc
Plasmid#114006Purposeexpress sgRNA, p15A, CRMDepositorInsertgRNA
PromoterBBa_J23119Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
BPK2101
Plasmid#65770PurposeBacterial expression plasmid for S. aureus Cas9 & sgRNA (need to clone in spacer into BsaI sites): T7-humanSaCas9-NLS-3xFLAG-T7-BsaIcassette-Sa-sgRNADepositorInsertmammalian codon-optimized SaCas9, and SaCas9 gRNA
UseCRISPRTagsNLS-3xFlagExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6.3>Control.gRNA.f+e
Plasmid#99140PurposeControl gRNA under the regulation of an optimized chicken specific U6 promoterDepositorInsertControl gRNA
UseCRISPRPromoterChicken U6.3Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-ack
Plasmid#62654PurposeArabinose inducible lambda red and anhydrotetracycline inducible sgRNA expressionDepositorInsertexo, beta, gam, sgRNA
ExpressionBacterialAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pICH41331::pU6cm-pegR::EURb7
Plasmid#227695PurposeGolden Gate level 0 acceptor vector for cloning altered epegRNA: altered epegRNA being driven by U6 composite promoter (pU6cm) and terminated by a dual terminator (EURb7).DepositorInsertAltered epegRNA backbone with cloning sites for gRNA and RTT.
UseCRISPRExpressionPlantPromoterU6 compositeAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
DR274
Plasmid#42250Purposeguide RNA (gRNA) expression vector used to create a gRNA to a specific sequence; uses T7 promoter for in vitro transcriptionDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR; Zebrafish expressionExpressionWormPromoterT7Available SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-NT
Plasmid#89960PurposeContains arabinose-induced lambda Red and a tet-inducible non-targeting gRNA containing BsmBI sites for cloning.DepositorInsertempty gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSQT1313
Plasmid#53370Purposemultiplex gRNA expression plasmidDepositorInsertNone
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330-BbsI-PITCh
Plasmid#127875PurposeFor user to clone their gRNA oligos to BbsI site. PITCh gRNA expression cassette is already build in so there is no need to perform Golden Gate assemblyDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-AtU6-1
Plasmid#66202Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only