We narrowed to 15,101 results for: EGF;
-
Plasmid#84383PurposeLentiviral expression of EGFP-tagged Lifeact with Blasticidin selection in cells including neuronsDepositorInsertLifeact
UseLentiviralTagsEGFPPromoterCMV immediate earlyAvailable SinceJan. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-MYC
Plasmid#242771PurposeAAV transfer plasmid expressing eGFP-MYC under a CAG promoter.DepositorInsertEGFP
UseAAVTagsMYCPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-3XHA-EGFP-OMP25
Plasmid#83356PurposeFor tagging mitochondria with HA epitopes (HA-MITO construct)DepositorInsert3XHA-EGFP-OMP25
UseRetroviralExpressionMammalianAvailable SinceSept. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Pur-CAG-EGFP
Plasmid#80945Purposehuman AAVS1 site targeting donor plasmid for knocking-in EGFP expression cassette driven by CAG promoterDepositorInsertEGFP
ExpressionMammalianPromoterCAG promoterAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-FUS/TLS-FLAGC
Plasmid#60362PurposePlasmid for expression of FLAG-GFP tagged human FUS/TLS (C-terminal tag). Confers resistance to G418.DepositorAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOTTC407 - pAAV EF1a eGFP
Plasmid#60058PurposeAn AAV packaging vector that expresses enhanced green fluorescent protein under control of the EF1a promoter.DepositorInsertenhanced Green Fluorescent Protein
UseAAVExpressionMammalianPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET28a SnoopTag-mEGFP-SpyTag
Plasmid#72325PurposeBacterial expression of monomeric enhanced green fluorescent protein (mEGFP) containing SnoopTag at the N-terminus and SpyTag at the C-terminus, for programmed polyprotein synthesis.DepositorInsertpET28a SnoopTag-mEGFP-SpyTag
TagsN-terminal His6 tagExpressionBacterialAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
458 p3E-2A-EGFP-CAAXpA
Plasmid#195968PurposeGateway p3E 2A fluorophoreDepositorInsert2A-EGFP-CAAX (membrane)
UseOtherAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase
Plasmid#119816Purpose3rd generation lentiviral plasmid for expression of EGFP Firefly Luciferase fusion protein in mammalian cellsDepositorInsertsLuciferase
Puromycin
UseLentiviral and LuciferaseTagsEGFP and V5ExpressionMammalianMutationStop codon removed in the frame of the V5 frame v…PromoterCMV/TO and Human Phosphoglycerate kinaseAvailable SinceJan. 2, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
TetOn-mCherry-eGFP-RAMP4
Plasmid#109014PurposeTet-On construct to induce expression of tandem eGFP-mCherry tagged RAMP4 (ER marker)DepositorInsertRAMP4 (SERP1 Human)
UseLentiviralTagsmCherry-eGFPExpressionMammalianPromoterCMV promoterAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAVone-AAV2-CMV-eGFP
Plasmid#230930PurposepAAVone plasmid is used to package AAV-CMV-eGFP with an AAV2 serotype, utilizing the AAVone single-plasmid AAV production system.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT)
Plasmid#196702PurposePlasmid for transient mammalian expression of wild type RNase H1 tagged with 2xNLS and EGFP that can be used to specifically degrade the nuclear R-loops.DepositorInserthuman RNaseH1 wild type
ExpressionMammalianAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCCL/IFNB1-d2eGFP-3’UTR
Plasmid#180232PurposeReporter plasmid utilizing d2eGFP as a reporter gene. Expression is designed to mimick IFNB1DepositorInsertd2eGFP
UseLentiviralPromoter1 kb upstream of IFNB1 CDSAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CBh-DIO-EGFP
Plasmid#87168PurposeExpression of eGFP in the presence of CreDepositorInsertEGFP
UseAAVTagsNoneAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_miniSOG2 T2A H2B-EGFP
Plasmid#87410PurposeMammalian expression vector encoding Histone 2B GFP fusion and miniSOG2DepositorInsertmini singlet oxygen generator 2
ExpressionMammalianAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28 His6-mEGFP-D4H
Plasmid#226373PurposeProduction of recombinant mEGFP-D4H, a fluorescent probe binding cholesterolDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-EGFP-NLS-3XFLAG-V5
Plasmid#196090PurposeExpresses gfp in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertGFP
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianPromoterCAGGsAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXR001: EF1a-CasRx-2A-EGFP
Plasmid#109049PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-EGFP for RNA targetingDepositorInsertCasRx
UseCRISPR and LentiviralTags2A-eGFP, HA, and NLSExpressionMammalianPromoterEF1AAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTU2-AmyE-Pveg-eGFP
Plasmid#112792PurposeExpresses GFP under the control of Pveg promoter and it is integrated into AmyE locus. Used to test correct transformationDepositorArticleInsertPveg-eGFP
ExpressionBacterialAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJC5-3XHA-EGFP-PEX26
Plasmid#139054PurposeHA-PEROXO Lentiviral Construct. Expresses a Peroxisomal Tag.DepositorInsert3XHA-EGFP-PEX26
UseLentiviralTagsHAPromoterUBCAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLPCX2-MT1-MMP-eGFP
Plasmid#89819PurposeExpress in MT1-MMP mammalian cellsDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-117:POLR2A-mEGFP
Plasmid#164500PurposeHomology arms and mEGFP-linker sequence sequence for N-terminus tagging of human POLR2ADepositorInsertPOLR2A Homology Arms with mEGFP-linker (POLR2A Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceFeb. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-Frankenbody-FLAG-mEGFP
Plasmid#175293PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with mEGFP
TagsmEGFPExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pXR002: EF1a-dCasRx-2A-EGFP
Plasmid#109050PurposeCatalytically inactive dCasRx with 2A-EGFPDepositorInsertdCasRx
UseCRISPR and LentiviralTags2A-eGFP, HA, and NLSExpressionMammalianMutationR239A/H244A/R858A/H863AAvailable SinceApril 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-EGFP-EF1a-rtTA
Plasmid#104454PurposePiggyBac plasmid expressing EGFP under the control of a doxycycline-inducible promotorDepositorInsertsenhanced green fluorescent protein
reverse tetracycline-controlled transactivator 3
UsePiggybacExpressionMammalianAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
CHIKV eGFP-Zeo replicon
Plasmid#249289PurposeSP6-driven CHIKV_LR2006 OPY1 replicon with eGFP-Zeocin reporter selection cassetteDepositorInsertCHIKV LR2006-OPY1 replicon harboring nonstructural genes (nsp1-nsp4) and eGFP-Zeocin ORF in place of structural genes
ExpressionBacterialMutationstructural polyprotein open reading frame deleted…PromoterSP6Available SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-EGFP-KASH
Plasmid#154373PurposeVector for Cre-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAV and Cre/LoxExpressionMammalianAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRK5-EGFP-Tau P301L
Plasmid#46908Purposeexpresses EGFP tagged Tau P301L in mammalian cellsDepositorAvailable SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT_mEGFP-SNAP-tag2
Plasmid#226513PurposeMamalian cell expression of cytosolic mEGFP-SNAP-tag2DepositorInsertmEGFP-SNAP-tag2
ExpressionMammalianAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-eGFP-53BP1
Plasmid#60813Purposemammalian expression vectorDepositorAvailable SinceDec. 9, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC19 - T7 pro - IRES - EGFP
Plasmid#138586PurposeExpress EGFP with an upstream T7 promoter in pUC19 backboneDepositorInsertEGFP
Available SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Puro-P2A-EGFP
Plasmid#137729PurposeFor simple determination of the multiplicity of infection (MOI) of a lentiviral CRISPR library by checking EGFP expression (still allowing for puro selection).DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsEGFPExpressionBacterial and MammalianAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
FUGW-Arl13b-PR-EGFP-TurboID
Plasmid#248194PurposeLentiviral expression of truncated Arl13b containing the Proline-Rich domain at the C-terminus (cytosol localization)DepositorInsertThe Arl13b noncilium targeting sequence-EGFP-TurboID (Arl13b Mouse)
UseLentiviralTagsEGFP and TurboIDExpressionMammalianMutationTruncated to only contain the PR domainPromoterhUBCAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EGFP-IRES-Neo
Plasmid#128660Purposemammalian expression of EGFP with neomycin selectionDepositorInsertEGFP
UseLentiviralTagsN/AExpressionMammalianMutationWild typePromoterCMVAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-eGFP-2A-mCherry_D4H
Plasmid#194875PurposeRatiometric D4H sensor for in vivo neuron-specific cholesterol visualizationDepositorInsertGFP-T2A-mCherry-D4H
UseAAVExpressionMammalianPromoterhuman SynapsinAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EGFP-IRES-puro
Plasmid#128652Purposemammalian expression of EGFP with puromycin selectionDepositorInsertEGFP
UseLentiviralTagsN/AExpressionMammalianMutationWild typePromoterCMVAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-EGFP
Plasmid#50457PurposeDouble floxed EGFP under the control of human synapsin promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEGFP
UseAAVTagsN/APromoterhuman Synapsin 1Available SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMRX-hSTING (N154S)-EGFP
Plasmid#214150PurposeRetroviral transduction of STINGDepositorAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVone-AAV9-CMV-eGFP
Plasmid#230928PurposepAAVone plasmid is used to package AAV-CMV-eGFP with an AAV9 serotype, utilizing the AAVone single-plasmid AAV production system.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only