We narrowed to 10,133 results for: gnas
-
Plasmid#40591PurposeMouse astrocyte expression of CreDepositorInsertCre recombinase (GFAP Mouse, Human, Phage)
UseCre/Lox and Mouse TargetingTagsMP-1 fragment (mouse protamine 1 intron and polya…ExpressionMammalianMutationConstruct contains a nuclear-targeted Cre recombi…PromoterhGFAP promoterAvailable SinceSept. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGS-FCER1G-1
Plasmid#109192PurposeEncodes human full-length FCER1G to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTCH2_pLX307
Plasmid#98354PurposeLentiviral expression of MTCH2DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.PAC
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ALK6 Q203D
Plasmid#80883Purposemammalian expression of ALK6 Q203DDepositorInsertALK6 (Bmpr1b Mouse)
TagsHAExpressionMammalianMutationQ203D (constitutively active)PromoterCMVAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
BMP4_pLX307
Plasmid#98321PurposeLentiviral expression of BMP4DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-N-3XFLAG-Lrp6
Plasmid#123595DepositorInsertlow density lipoprotein receptor-related protein 6 (Lrp6 Mouse)
TagsFLAGExpressionMammalianAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE-neomycin-PC-MYC
Plasmid#184550PurposeRetroviral vector to express human PC with MYC tagDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMal-Abl-PRM 5R
Plasmid#112088PurposeBacterial expression plasmid containing His and MBP tags for 5 PRM motif repeats of Human Abl.DepositorInsertPRM-5R (ABL1 Human)
TagsHis-6 and MBPExpressionBacterialMutationconstruct contains only the PRM motif of Abl1PromoterLacAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
GABA(A) receptor subunit a2SE
Plasmid#49169PurposepHluorin-tagged GABA A receptor subunit (alpha 2) produces minimal fluorescence during trafficking and a robust fluorescent signal at the cell surfaceDepositorInsertGABA(A) receptor subunit alpha-2 (GABRA2 Human)
TagsHA, bovine alpha 1 signal sequence, and pHGFP (pH…ExpressionMammalianMutationT343APromoterCMVAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
ADSL_pLX307
Plasmid#98311PurposeLentiviral expression of ADSLDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-hBVRA
Plasmid#100285PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for human BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for human BVRA
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV Jph3gRNA mEmerald hSyn mTagBFP2-CAAX2
Plasmid#236246PurposeEndogenous tagging of Junctophilin 3 with mEmerald with a fluorescent marker for the plasma membraneDepositorInsertgRNA for rat Jph3, mEmerald donor and mTagBFP2-CAAX2
UseAAVTagsmTagBFP2PromoterU6 and human Synapsin1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-FLAG-KORD-P2A-ArgiNLS-AausFP1
Plasmid#220610PurposeNeuron-specific, Cre-dependent co-expression of FLAG-tagged inhibitory KORD DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporterDepositorInsertFLAG-KORD-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterhSynAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EREG-ScNeo
Plasmid#209896PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
UseLentiviralTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EPGN-ScNeo
Plasmid#209899PurposeTo monitor the status of Epigen, the plasmid encodes a recombinant Epigen fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF5-FRT-V5-DEST-GFP-Kif26b
Plasmid#102862PurposeExpresses GFP-Kif26b in mammalian cellsDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER22-MKK6E-Flag
Plasmid#99259PurposeLentiviral vector encoding a doxycycline-inducible Flag-tagged constitutively active MKK6.DepositorInsertMKK6E (MAP2K6 Human)
UseLentiviralTagsFlagExpressionMammalianMutationS207E T211EPromoterTRE2Available SinceAug. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-EREG-ScNeo
Plasmid#209905PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
TagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
TCF7L2_pLX307
Plasmid#98373PurposeLentiviral expression of TCF7L2DepositorInsertTCF7L2 (TCF7L2 Human)
UseLentiviralTagsV5ExpressionMammalianMutationIsoform X25PromoterE1FaAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-FLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
Plasmid#220613PurposeCre-dependent co-expression of FLAG-tagged inhibitory hM4D(Gi) DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterEF1aAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-3xHA-hM3D(Gq)-P2A-ArgiNLS-oScarlet
Plasmid#220614PurposeCre-dependent co-expression of 3x HA-tagged excitatory hM3D(Gq) DREADD receptor, and a single-cell discriminating version of oScarlet as a reporter.DepositorInsert3x HA-hM3D(Gq)-P2A-AgiNLS-oScarlet
UseAAV and Cre/LoxTags3x HA; ArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EGF-ScNeo
Plasmid#209893PurposeTo monitor the status of EGF, the plasmid encodes a recombinant EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-HBEGF-ScNeo
Plasmid#209894PurposeTo monitor the status of HB-EGF, the plasmid encodes a recombinant HB-EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMal_Abl-PRM 3R
Plasmid#112086PurposeBacterial expression plasmid containing His and MBP tags for 3 PRM motif repeats of Human Abl.DepositorInsertAbl-PRM-3R (ABL1 Human)
TagsHis-6 and MBPExpressionBacterialMutationconstruct contains only the PRM motif of Abl1PromoterLacAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSH1/M-FGFR1-Fv-Fvls-E
Plasmid#15285DepositorInsertFGFR1 kinase, FKBP12v36 (Fgfr1 Mouse)
TagsHA epitope and Myristoylation-targeting domain c-…ExpressionMammalianMutationFGFR1 cytoplasmic domain FKBP12 F36VAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-CD79B-RFP
Plasmid#187005PurposeExpression of human CD79B as RFP fusion proteinDepositorAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BCR-ABL1
Plasmid#232952PurposeExpresses BCR-ABL1 fusion proteinDepositorInsertBCR-ABL1 (BCR Human)
UseLentiviralAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACO2_pLX307
Plasmid#98312PurposeLentiviral expression of ACO2DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
CCNT1_pLX307
Plasmid#98328PurposeLentiviral expression of CCNT1DepositorInsertCCNT1 (CCNT1 Human)
UseLentiviralTagsV5ExpressionMammalianMutationH519R, S566P, and P712SPromoterE1FaAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRY2high-mCherry-Raf1
Plasmid#104064PurposeExpresses fusion of CRY2high mutant (CRY2PHR E490R) with mCherry and Raf1DepositorExpressionMammalianMutationCRY2PHR E490RPromoterCMVAvailable SinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
CSNK1A1_pLX307
Plasmid#98326PurposeLentiviral expression of CSNK1A1DepositorAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMAL-Abl-PRM 4R
Plasmid#112087PurposeBacterial expression plasmid containing His and MBP tags for 4 PRM motif repeats of Human Abl.DepositorInsertAbl-PRM-4R (ABL1 Human)
TagsHis-6 and MBPExpressionBacterialMutationconstruct contains only the PRM motif of Abl1PromoterLacAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-CD79B-YFP
Plasmid#187006PurposeExpression of human CD79B as YFP fusion proteinDepositorAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL7.0: hITSN1(1159-1509)-tgRFPt-SSPB WT
Plasmid#60419PurposeMammalian Expression of ITSN DH/PH-tgRFPt-NanoDepositorInserthITSN1-tgRFPt-SSPB (ITSN1 Human, Synthetic)
UseCre/Lox and LentiviralTagstgRFPtExpressionMammalianMutationhITSN 1159-1509 // SSPB Y11K and A15EPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-N-3XFLAG-Ubxd8
Plasmid#123599DepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHOT-P2Y2R
Plasmid#159108Purposeentiviral vector encoding P2Y purinoceptor 2 (P2Y2R), a high affinity G-protein coupled receptor that mobilizes Ca2+ from intracellular stores upon binding extracellular ATP.48,49 By using the GibsonDepositorInsertP2Y2R
UseLentiviralPromoterUBCAvailable SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFP-GIGYF1
Plasmid#141188PurposeExpresses GFP-GIGYF1 in mammalian cells, can be used to make inducible cell lineDepositorAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
FERMT1_pLX307
Plasmid#98333PurposeLentiviral expression of FERMT1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-H2B-iRFP670-p2a-mCerulean-Cdt1 (1-100)-IRES-puromycin
Plasmid#223965PurposeDual fluorescent reporter for histone H2B and for Cdt1DepositorUseLentiviralTagsiRFP670 and mCeruleanExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pPBbleo-EGF-ScNeo
Plasmid#209902PurposeTo monitor the status of EGF, the plasmid encodes a recombinant EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEGF-ScNeo (EGF )
TagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-NR4A3-P2A-mCherry
Plasmid#203863PurposeTet-inducible lentiviral plasmid expressing NR4A3-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertNR4A3 (NR4A3 Human)
ExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
Flag-hPKL WT
Plasmid#107159PurposeFor mammalian expression of Flag-hPKL WTDepositorAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE-α-Syn-nYFP
Plasmid#92203PurposeRetroviral overexpression vector for α-Syn bimolecular fluorescence complementation (BiFC)DepositorAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3xFLAG-RSL1D1(WT)
Plasmid#122301Purposeexpresses RSL1D1 protein with a flag tagDepositorAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/FGFR2-S252W(Apert) myc
Plasmid#33249DepositorInsertFGFR2 (Fgfr2 Mouse)
TagsHis and MycExpressionMammalianMutationMutation S252W in FGFR2 found in Apert syndrome. …PromoterCMVAvailable SinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLL7.0: hITSN1(1159-1509)-tgRFPt-SSPB R73Q
Plasmid#60420PurposeMammalian Expression of ITSN DH/PH-tgRFPt-MicroDepositorInserthITSN1-tgRFPt-SSPB (ITSN1 Human, Synthetic)
UseCre/Lox and LentiviralTagstgRFPtExpressionMammalianMutationhITSN 1159-1509 // SSPB R73Q, Y11K and A15EPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-FoxO1_1R_13A_3D
Plasmid#106279PurposeFluorescent fusion protein for FoxO1DepositorInsertsTagsClover fluorescent protein and NLSExpressionMammalianMutationDeleted amino acids 401-636, T24A, S209A, H212R, …PromoterEF1a/RPBSAAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only