We narrowed to 9,396 results for: CAG
-
Plasmid#120807PurposeFRET biosensor. Eliminating the H3 lysine 9 methylation site in H3K9me3 biosensor to abolish the detection capabilityDepositorInsertTruncated YPet-HP1-EV linker-ECFP-mouse histone H3(K9L mutation)
ExpressionMammalianMutationlysine 9 is mutated to leucine 9 on histone H3PromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
W45A mutant of H3K9me3 biosensor
Plasmid#120808PurposeFRET biosensor. Disrupting HP1 binding capability in H3K9me3 biosensor to abolish the detection capabilityDepositorInsertTruncated YPet-HP1(W45A mutation)-EV linker-ECFP-mouse histone H3
ExpressionMammalianMutationTryptophan 45 is mutated to Alanine 45 on HP1 dom…PromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF1438
Plasmid#143807PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK2/PKR_sgRNA
Plasmid#218527PurposesgRNA targeting human EIF2AK2/PKRDepositorInsertEIF2AK2 (EIF2AK2 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shRUNX1 puro
Plasmid#45816DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3_nsgRNA(PP7)
Plasmid#232444PurposensgRNA for PE3 facilitation of a +1 T to A prime edit on the HEK3 locus, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3) for HEK3+1t>a edit driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF0208
Plasmid#142556PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
WT1 KI gRNA1
Plasmid#92312PurposeCRISPR-GFP-gRNA for cutting WT1DepositorAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001149212)
Plasmid#77051Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001149358)
Plasmid#77052Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF0917
Plasmid#142198PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 sgNRF2-4
Plasmid#186839Purposeknock out NRF2 in mammalian cellsDepositorInsertNrf2 (Nuclear factor-erythroid factor 2-related factor 2) (NFE2L2 Human)
UseCRISPR and LentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSmarca4#1/Cre
Plasmid#173619PurposeExpresses a Smarca4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Smarca4 (Smarca4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mAtp6v1a-2
Plasmid#198478Purposelentiviral stable expression of mAtp6v1a gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-mTagBFP2-rMPC1 shRNA
Plasmid#229016PurposeExpression of an shRNA construct that knocks down rat MPC1. This plasmid also encodes a blue fluorescent protein tag to verify transfectionDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3052
Plasmid#144528PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
mEtfdh CRISPR_1
Plasmid#232312PurposeMouse Etfdh Gene Knockout (gRNA 1)DepositorInsertEtfdh-targeting gRNA (Etfdh Mouse)
UseLentiviralAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hCRY1 c-term
Plasmid#179453PurposeLentiviral Crispr/Cas9 plasmid targeting hCRY1 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human CRY1
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
Phage-PGK-Flag-HA-FKBP-T(WT)
Plasmid#181734Purposefor lentiviral expression of brachyury ORF in mammalian cellsDepositorInsertT (brachyury)
UseLentiviralMutationa silent mutation in the PAM site of an sgRNAt ta…Available SinceMarch 21, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
lentiCRISPR v2-sgBAP1-1
Plasmid#125837PurposeKO BAP1 geneDepositorInsertBAP1 (BRCA1 associated protein 1) (BAP1 Human)
UseLentiviralAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4404
Plasmid#115465PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EP400
Plasmid#226449PurposeFor subcloning of human EP400 promoter or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i1-ipUSEPR-TR657
Plasmid#228953PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i1 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF0210
Plasmid#142557PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN35-CDKN2A-Ex2-L
Plasmid#110736PurposeEncodes Cas9 nickase and gRNA targeting CDKN2A Exon2DepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-RAB11a KI
Plasmid#131499PurposeEndogenous tagging of RAB11: N-terminal (amino acid position: before startcodon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-myc-his-BACH1 P47A
Plasmid#17644DepositorInsertBACH1 (BRIP1 Human)
TagsHis and MycExpressionMammalianMutationTo generate the tumor-associated mutant, the prol…Available SinceApril 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA2-gRNA_A
Plasmid#74376PurposegRNA_A to knockout human AMPK alpha 2 using Cas9n.DepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_v2_Dual_epegRNA_tevopreQ1
Plasmid#187456PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4_v2 optimized epegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R_v2 epegRNA (tevopreQ1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_pegRNA_(PP7-C4-Q1)
Plasmid#232435PurposepegRNA with optimized 3' modifications to correct the rd12 mutationDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_nsgRNA(PP7)
Plasmid#232436PurposensgRNA for PE3b correction of the rd12 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPN440
Plasmid#137874PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRa; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-S45
Plasmid#164587PurposeExpresses a gRNA that overlaps the S45 codon of human CTNNB1DepositorAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
shBCL2L1 # 2
Plasmid#42552DepositorAvailable SinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pB-TetOn-DEST-hEF1a-mODC-rtTA-IRES-NEO (JDW 1130)
Plasmid#229839PurposeA CAGGS driven, piggybac compatible, tet-on expression vector containing a luciferase reporter followed by a P2A cleavage peptide and H2A fused mCherry for nuclear labeling.DepositorInsertLuciferase
ExpressionMammalianAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
KAT2A sgRNA2
Plasmid#138186Purpose3rd generation lentiviral gRNA plasmid targeting human KAT2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSmarca4#2/Cre
Plasmid#173620PurposeExpresses a Smarca4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Smarca4 (Smarca4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
CSNK1G2 gRNA (BRDN0001149101)
Plasmid#76989Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1G2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-beta2 RD-1-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128343PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
FOR human OCT4 TALEN
Plasmid#52412PurposeTALEN expressing vector used to allow Knock-in of OCT4-GFP-2A-PURO knockin donor plasmid (generated by Jaenisch lab- Addgene Vector # 31939)DepositorInsertHD NG NN NN NN HD NG HD NG HD HD HD NI NG
UseTALENPromoterCAGGSAvailable SinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_HH-EMX1 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA
Plasmid#176459PurposeVector for expressing retron Ec73ncRNA-gRNA chimeric RNA (rgRNA) targeting EMX1 driven by EF1alpha promoter and and EGFP(L138S)-P2A-mCherry driven by CMVDepositorInsertHH-EMX1 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-NCBD + ACTR
Plasmid#99335PurposeBacterial coexpression of CBP NCBD and NCoA3 binding domainsDepositorExpressionBacterialPromoterT7Available SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pv6_MECP2_MBD
Plasmid#179407PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of MECP2_MBDDepositorAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
KSR2 gRNA (BRDN0001147424)
Plasmid#76425Purpose3rd generation lentiviral gRNA plasmid targeting human KSR2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgRB1#2
Plasmid#174145PurposeLentiviral vector expressing a sgRNA against the human RB1 geneDepositorInsertRB1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDK14 gRNA (BRDN0001148240)
Plasmid#76640Purpose3rd generation lentiviral gRNA plasmid targeting human CDK14DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only