We narrowed to 8,888 results for: tre promoter
-
Plasmid#170229PurposeBarcoded lentiviral vector to express Rheb (Q64L) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorInsertRHEB (RHEB Human)
UseLentiviralTagsFLAGExpressionMutationQ64LPromoterEF1aAvailable sinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-mScarlet
Plasmid#227274PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing mScarlet. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-mScarlet cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SPI1_P2A_Hygro_Barcode
Plasmid#120482PurposeBarcoded lentiviral vector to express SPI1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertSPI1 (SPI1 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-PURO-LoxP-HaloTERT WT HR Donor
Plasmid#86843PurposeHR Donor for N-terminal FLAG-HaloTag-TERT fusion in human cells. Includes Puro selection marker flanked by LoxP sites.DepositorInsertFLAG-HaloTag-TERT Exon 1 and part of Exon 2 (TERT Human)
UseTagsFLAG-HaloTagExpressionMammalianMutationPromoterEndogenous TERT promoterAvailable sinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SOX10_P2A_Hygro_Barcode
Plasmid#120479PurposeBarcoded lentiviral vector to express SOX10 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertSOX10 (SOX10 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MITF_P2A_Hygro_Barcode
Plasmid#120460PurposeBarcoded lentiviral vector to express MITF in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMITF (MITF Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
Renilla luciferase-Pol III
Plasmid#37380DepositorInsertPolIII-Renilla control reporter (RpIII128 Fly)
UseLuciferaseTagsExpressionMammalianMutationPromoterRNA PolIII 128 subunit (RpIII128)Available sinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 RPEL1-EGFP-3XNLS
Plasmid#58469PurposeExpresses a nuclear-targeted monomeric actin reporter, consisting of the RPEL1 domain from MAL/MRTF, on a CMV promoterDepositorInsertsUseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYOD1_P2A_Hygro_Barcode
Plasmid#120464PurposeBarcoded lentiviral vector to express MYOD1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYOD1 (MYOD1 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-OVOL1-T2A-PuroR
Plasmid#162347PurposeLentiviral expression of OVOL1 under the control of the TetON promoterDepositorInsertOVOL1 (OVOL1 Human)
UseLentiviralTagsT2A-PuroRExpressionMammalianMutationPromoterTet-ONAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP-WPRE
Plasmid#127864PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse)
UseAAVTags3xFLAG and mCherryExpressionMutationPromoterhSynAvailable sinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJT040 lenti MCS pEF mIFP WPRE
Plasmid#161929PurposeLentiviral expression of mIFP with multiple cloning site upstream the pEF promoterDepositorInsertmIFP
UseLentiviral and Synthetic BiologyTagsExpressionMammalianMutationPromoterpEFAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanGlow-GL
Plasmid#83342Purposefor Gateway cloning of promoter elements upstream of a GFP::Luciferase(nls) reporter, facilitating qualitative and quantitative analysis of expression in transgenic fly lines and S2 cells.DepositorTypeEmpty backboneUseLuciferaseTagsGFP::Luciferase(nls)ExpressionInsectMutationPromoterAvailable sinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-eGFP-SynaptoZip
Plasmid#122525PurposeAAV expression of the synaptic activity-marker SynaptoZip fused to eGFP driven by human Synapsin promoterDepositorInserteGFP-SynaptoZip (Vamp2 Rat)
UseAAVTagsMyc and eGFPExpressionMammalianMutationPromoterhSynAvailable sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanGlow-RR
Plasmid#83343Purposefor Gateway cloning of promoter elements upstream of a mCherry::Renilla(nls) reporter, facilitating qualitative and quantitative analysis of expression in transgenic fly lines and S2 cells.DepositorTypeEmpty backboneUseLuciferaseTagsmCherry::Renilla(nls)ExpressionInsectMutationPromoterAvailable sinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hPGK-mCherry-SynaptoZip
Plasmid#177317PurposeLentiviral expression of the synaptic activity-marker SynaptoZip fused to mCherry driven by hPGK promoterDepositorInsertmCherry-SynaptoZip (Vamp2 Rat)
UseLentiviralTagsMyc and mCherryExpressionMammalianMutationPromoterAvailable sinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-miniSOG-VAMP2-citrine
Plasmid#50969PurposeAAV2 transfer vector containing the InSynC (miniSOG-VAMP2-citrine) constructDepositorInsertminiSOG-VAMP2-citrine (Vamp2 Mouse, Arabdopsis thaliana)
UseAAVTagscitrine and miniSOGExpressionMutationPromoterhuman synapsin promoterAvailable sinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
EF1a_POU1F1_P2A_Hygro_Barcode
Plasmid#120473PurposeBarcoded lentiviral vector to express POU1F1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertPOU1F1 (POU1F1 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E WT
Plasmid#110123PurposeExpresses Flag-tagged D. melanogaster Hel25EDepositorInsertHel25E (Hel25E Fly)
UseTagsFlagExpressionInsectMutationPromoterMetallothionein Promoter (pMT)Available sinceOct. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
HSC1-D4Z4-GiP
Plasmid#58542PurposeDerived from HSC1-GiP where the D4Z4 insulator is cloned upstream of the EF1 alpha promoterDepositorInsertsEnhanced Green Fluorescence Protein, Puromycin resistance gene
D4Z4 repeat, partial
UseRetroviralTagsExpressionMammalianMutationPromoterHuman EF1-alphaAvailable sinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/FLAG-hPMR1-Tev-Bio
Plasmid#80125PurposeExpresses human PMR1 endonuclease with N-terminal FLAG and C-terminal biotinylation tagsDepositorInsertPXDNL-003 (PXDNL Human)
UseTagsFLAG and biotinylationExpressionMammalianMutationPromoterCMV promoterAvailable sinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUASp-FMW-attB-AthHen1
Plasmid#104957PurposeExpression of FLAG Myc tagged A.thaliana-Hen1 (codon optimised for Drosophila) in Drosophila germline tissues using Gal4 driversDepositorInsertHen1 (HEN1 Mustard Weed)
UseTagsFLAG MycExpressionInsectMutationPromoterpTrasposase promoterAvailable sinceJan. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDSM-de-Pfba1-PYC-Trpl15a
Plasmid#127738PurposeYeast pathway position 5. PYC transcription unit with the FBA1 promoter and RPL15A terminator.DepositorInsertpyruvate carboxylase (PYC1 Budding Yeast, Synthetic)
UseSynthetic BiologyTagsExpressionYeastMutationPromoterPfba1Available sinceJan. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUASt-FMW-attB-AthHen1
Plasmid#104958PurposeExpression of FLAG Myc tagged A.thaliana-Hen1 (codon optimised for Drosophila) in Drosophila using somatic tissue Gal4 driversDepositorInsertHen1 (HEN1 Mustard Weed)
UseTagsFLAG MycExpressionInsectMutationPromoterHsp70 promoterAvailable sinceJan. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
-
pSG059
Plasmid#214262PurposePaFtsH2-6xHis cloned in XbaI/NheI site in pET-28a(+)DepositorInserttLST accessory element PaFtsH2 protease of Pseudomonas aeruginosa SG17M
UseTags6x His-tag and 6xHis-tagExpressionBacterialMutationPromoterT7 promoterAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
10X PRE TK luc
Plasmid#206162PurposeLuciferase reporter construct containing 10 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert10X PRE TK luciferase
UseLuciferaseTagsExpressionMammalianMutationPromotermin TKAvailable sinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
8X PRE TK luc
Plasmid#206161PurposeLuciferase reporter construct containing 8 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert8X PRE TK luciferase
UseLuciferaseTagsExpressionMammalianMutationPromotermin TKAvailable sinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
6X PRE TK luc
Plasmid#206160PurposeLuciferase reporter construct containing 6 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert6X PRE TK luciferase
UseLuciferaseTagsExpressionMammalianMutationPromotermin TKAvailable sinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSynW pHluorin-SYT9 IRES mRuby3
Plasmid#195698PurposeLentiviral plasmid encoding SYT9 with an N-terminal pHluorin tag followed by an internal ribosomal entry site followed by mRuby3 under the human synapsin promoterDepositorInsertSyt9 (Syt5 Rat)
UseLentiviralTagspHluorinExpressionMutationPromoterAvailable sinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSynW Syt9 IRES mRuby3
Plasmid#195700PurposeLentiviral plasmid encoding full-length mouse SYT9 followed by an internal ribosomal entry site followed by mRuby under the human synapsin promoterDepositorInsertSyt9 (Syt5 Mouse)
UseLentiviralTagsExpressionMutationencodes only the first 68 amino acids of Tac1PromoterAvailable sinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only