We narrowed to 9,728 results for: Gnas
-
Plasmid#74054Purposeretroviral expression plasmid for human NFATc2/C (without C-terminal region) with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 Human, AS 1-686 (N terminus deleted))
UseRetroviralTagsAVI-TEVExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…PromoterpMSCV-LTRsAvailable sinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-RGS7t
Plasmid#55761PurposeAn amino-terminal CFP Fragment was fused to residues 202-477 of RGS7. When co-expressed with a carboxyl terminal fragment of CFP fused to Gbeta-5, a fluorescent signal is produced.DepositorInsertRGS7(202-477)-CFP(1-158) (RGS7 Aequorea victoria, Human)
UseTagsCFP(1-158) was fused to the amino terminus of RGS…ExpressionMammalianMutationThe RGS sequence amino terminal to the GGL domain…PromoterCMVAvailable sinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
-
pmCherry-C1 R62D actin-3XNLS P2A mCherry
Plasmid#58477PurposeExpresses nuclear-targeted non-polymerizing R62D mutant of human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsUseTagsmCherryExpressionMammalianMutationChanged Arginine 62 to Aspartic AcidPromoterCMVAvailable sinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Chronos-tdTomato]
Plasmid#84484PurposeAAV-mediated expression of Chronos-tdTomato under the CAG promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationPromoterCAGAvailable sinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-ChrimsonR-tdTomato
Plasmid#99231PurposeAAV-mediated expression of ChrimsonR-tdTomato under the CaMKII promoter. tdTomato has codons varied between the first and second tandem repeats to reduce recombination. Using SV40 signal.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationChrimson K176R mutantPromoterCaMKIIAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.VSVg_NGFR
Plasmid#158244PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
GPER-DuET
Plasmid#213256PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPER (GPER1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-tdTomato
Plasmid#62726PurposeAAV-mediated expression of Chronos-tdTomato under the Syn promoter. Using bGHpA signal. tdTomato has codons varied between the first and second tandem repeats to reduce recombination.DepositorHas ServiceAAV8InsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationPromoterhuman synapsin promoterAvailable sinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [ChrimsonR-GFP]
Plasmid#84480PurposeAAV-mediated expression of ChrimsonR-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterhuman synapsin promoterAvailable sinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOT_5 - lenti-EFS-FMC6.3-28z-2A-puro-2A-tNGFR
Plasmid#181974PurposeExpresses anti-CD19 CAR (with CD28 signaling domain) linked to puromycin resistance via P2A and to human truncated NGFR via T2A for lentiviral delivery.DepositorInsertFMC6.3-28z CAR; tNGFR (NGFR Human, Synthetic)
UseLentiviralTagsExpressionMutationNGFR truncation: aa 11-276PromoterAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 actin-3XNLS P2A mCherry
Plasmid#58475PurposeExpresses nuclear-targeted human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsUseTagsmCherryExpressionMammalianMutationPromoterCMVAvailable sinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
CXCR4-DuET
Plasmid#213221PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCXCR4 (CXCR4 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCR6-DuET
Plasmid#213202PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCCR6 (CCR6 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP
Plasmid#112677PurposeAn AAV vector that expresses a Cre-dependent nuclear-localized Red to Green Fluorescent proteinDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertNuclear-localized floxed-mCherry EGFP
UseAAVTagsNuclear localization signalExpressionMutationPromoterEF1aAvailable sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.FLAG_NGFR
Plasmid#158250PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
iChr2-Notch Mosaic (SO250)
Plasmid#99752PurposeSecond generation Rosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different chromatin localized fluorescent proteins and Notch signalling genesDepositorInsertHIs-H2B-Cherry, H2B-EGFP-V5, HA-H2B-Cerulean, DN-Maml1, NICD-PEST
UseCre/Lox and Mouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOT_6 - lenti-EFS-FMC6.3-BBz-2A-puro-2A-tNGFR
Plasmid#181975PurposeExpresses anti-CD19 CAR (with 4-1BB signaling domain) linked to puromycin resistance via P2A and to human truncated NGFR via T2A for lentiviral delivery.DepositorInsertFMC6.3-BBz CAR; tNGFR (NGFR Human, Synthetic)
UseLentiviralTagsExpressionMutationNGFR truncation: aa 11-276PromoterAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Archon1-KGC-GFP-ER2
Plasmid#115892PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the Syn promoter. Using bGHpA signal.DepositorHas ServiceAAV8InsertArchon1-KGC-EGFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationPromoterSynAvailable sinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-STAT-CA
Plasmid#195576PurposeExpresses STAT3 constitutively active mutantDepositorInsertSignal transducer and activator of transcription 3 (Stat3 Mouse)
UseAAVTagsExpressionMammalianMutationchanged Alanine 662 to Cysteine and Asparagine 66…PromoterCMV enhancer and promoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-ChrimsonR-GFP
Plasmid#122063PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α promoter (1.1kb short version). Using SV40 pA signal.DepositorHas ServiceAAV2InsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1a(1.1kb short version)Available sinceMarch 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Jaws-KGC-GFP-ER2
Plasmid#99233PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the CAG promoter. Using bGH pA signal.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterCAGAvailable sinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[Chronos-GFP]
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianMutationPromoterhuman synapsin promoterAvailable sinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-PPO-Venus
Plasmid#139505PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the Ef1a promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV8 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianMutationPromoterEf1aAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Chronos-tdTomato]
Plasmid#84481PurposeAAV-mediated expression of Chronos-tdTomato under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationPromoterhuman synapsin promoterAvailable sinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
A3Bi-ctd-Cas9n-UGI-NLS
Plasmid#109426PurposeExpresses the C-terminal catalytic domain of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
UseCRISPRTagsExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[CoChR-GFP]
Plasmid#62724PurposeAAV-mediated expression of CoChR-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertCoChR-GFP
UseAAVTagsGFPExpressionMammalianMutationPromoterhuman synapsin promoterAvailable sinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-NES-ZapCV2 (cpV143)
Plasmid#112060PurposeGenetically-encoded Cyan-Yellow Zinc FRET sensor. Localizes to the cytosol. Useful for detecting free zinc ion levels in the cytosol (in vitro Kd ~2.3 nM, n = 0.53)DepositorInsertNES-ZapCV2
UseTagsNuclear Export Signal (NES) derived from HIV-1ExpressionMammalianMutationECFP gene is truncated 36 bp at 3' end. Venu…PromoterCMVAvailable sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1442 - pAAV CMV-IE Nuc-iRFP-2A-iCre
Plasmid#112683PurposeAn AAV vector that expresses a nuclear-localized iRFP713 reporter and improved Cre recombinaseDepositorInsertiRFP713
UseAAVTags2A-iCre and Nuclear localization signalExpressionMutationPromoterCMV-IEAvailable sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus
Plasmid#139504PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV5Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
DNA-CARzeta-GFP
Plasmid#89344Purpose2nd generation lentiviral vector which expresses DNA-CAR receptor fused to GFPDepositorUseLentiviralTagsSNAPf tag and mEGFPExpressionMammalianMutationPromoterAvailable sinceJune 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag_HsIRE1a_deltaP29_D408_K599A_pBabePuro
Plasmid#58492Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408 and bearing mutation K599A (kinase domain mutant)DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationdeleted amino acids P29 to D408 and bearing mutat…PromoterAvailable sinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTT5-hSDC1-S15/25A
Plasmid#52364Purposeexpresses human Syndecan-1 serine 15 and 25 mutated to alanine (numbering excludes signal peptide) in HEK293-EBNA1 (293E) suspension culture.DepositorInsertSDC1 (SDC1 Human)
UseTagsExpressionMammalianMutationS15A, S25A and R95Q (according to numbering in Fi…PromoterCMVAvailable sinceDec. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.AU1.VSVg_NGFR
Plasmid#158351PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.AU1.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-EGFP-GPI-stop-L2
Plasmid#186355PurposeEntry clone with ORF encoding plasma membrane-targeted EGFP-GPI fusion protein flanked by Gateway recombination sequencesDepositorInsertsignal peptide of human CD59, eGFP, aa 67-102 of human CD59 which contains the GPI attachment site (CD59 Human, Synthetic)
UseExpression of a fluorescent membrane markerTagsEGFPExpressionMutationPromoterAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-fd [Chronos-GFP]
Plasmid#84482PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/forward (Cre-dependent) manner. Cre turns gene off. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianMutationPromoterhuman synapsin promoterAvailable sinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
A3Ai E72A-Cas9n-UGI-NLS
Plasmid#109430PurposeExpresses catalytically inactive human APOBEC3A with an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A E72A Catalytic Mutant (APOBEC3A Human)
UseCRISPRTagsExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
iMb-Notch-Mosaic (IR99.40)
Plasmid#99749PurposeRosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different membrane localized fluorescent proteins and Notch signalling genesDepositorInsertMbYFP, MbTomato, MbKate2, DN-Rbpj and NICD-PEST
UseCre/Lox and Mouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.VSVg_NGFR
Plasmid#158241PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-tdTomato
Plasmid#122099PurposeAAV-mediated expression of Chronos-tdTomato under the EF1α promoter (1.1kb short version). tdTomato has codons varied to reduce recombination. Using SV40 pA signal.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationPromoterEF1α (1.1 kb short version)Available sinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-beta-5 in pcDNAI/Amp
Plasmid#55708PurposeAn amino-terminal fragment of mCerulean was fused to Gbeta5. When co-expressed with a carboxyl terminal CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertmCer(1-158)-beta5 (GNB5 Aequorea victoria, Human)
UseTagsCer(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-5 was amplified via PCR, which added an N-t…PromoterCMVAvailable sinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1440 - pAAV CMV-IE Nuc-iRFP-2A-Flpo
Plasmid#112684PurposeAn AAV vector that expresses a nuclear-localized iRFP713 reporter and optimized Flp recombinaseDepositorInsertiRFP713
UseAAVTags2A-Flpo and Nuclear localization signalExpressionMutationPromoterCMV-IEAvailable sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [ChrimsonR-GFP]
Plasmid#108273PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1α promoter (1.1kb short version)Available sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Chronos-GFP]
Plasmid#84485PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianMutationPromoterEF1α, 1.1 kb long (short version)Available sinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.AU1.VSVg_NGFR
Plasmid#158239PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.AU1.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.VSVg_NGFR
Plasmid#158232PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag_MmPERK_S503_N1114_pBabePuro
Plasmid#58423Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant mouse PERK deleted from amino acids M1 to Y502. The remaining amino acids are S503 to N1114.DepositorInsertPERK (Eif2ak3 Mouse)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids M1 to Y502PromoterAvailable sinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIG-AVITEV- hNFATc1/aA
Plasmid#74057Purposeretroviral expression plasmid for human NFATc1/aA with N-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc1, isoform alpha-A (NFATC1 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianMutationmutation G1157A [R235Q] and the silent mutation C…PromoterpMSCV-LTRsAvailable sinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only