We narrowed to 10,763 results for: ESP
-
Plasmid#159165PurposeMitochondrial labile heme reporterDepositorInsertmito-yHS1-M7A,H102A
TagsCOX4 pre-sequenceExpressionYeastMutationMutated both Met 7 and His 102 of the cyt b562 mo…PromoterGPDAvailable SinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Ef1a-DIO-Egr3-EYFP-WPRE
Plasmid#186417PurposeOverexpression of Egr3 transcript variant 1 CDS under EF-1α promoterDepositorAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pUDR217
Plasmid#113872Purposeexpression of Cas9 programming sgRNA9 and sgRNA10 targetting MPH2-3 and MAL11 respectivelyDepositorInsertsgRNA9-MPH2-3 sgRNA10-MAL11
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mqg*
Plasmid#21175DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationPoint mutation at nucleotide 6163 (numbering acco…Available SinceAug. 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*
Plasmid#21172DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationPoint mutation at nucleotide 5114 (numbering acco…Available SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSN67
Plasmid#100124Purposeexpresses putative KLF4 DBD with a 6xHis tagDepositorInsertmCherry-P2A-putative KLF4 DBD with a 6xHis tag (KLF4 Human)
UseLentiviralExpressionMammalianMutationInsert corresponds to the DBD of KLF4Available SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSIIneo-TRE-hPhyB621- mCherry-HRasCT
Plasmid#139482PurposeExpresses PhyB621-mCherry-HRasCT in mammalian cells.DepositorInsertPhyB621 (PHYB Mustard Weed)
UseLentiviralTagsmCherry-HRasCTExpressionMammalianMutationG229L and deletion of aa Y at position 235 in mch…PromoterTet responsible elementAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pURD214
Plasmid#113871Purposeexpression of Cas9 programming sgRNA5 and sgRNA2 targetting HXT13-15-16 and HXT2 respectivelyDepositorInsertsgRNA5 HXT13-15-16 sgRNA2-HXT2
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDR220
Plasmid#113873Purposeexpression of Cas9 programming sgRNA8 and sgRNA7 targetting HXT10 and HXT9-11-12 respectivelyDepositorInsertsgRNA8-HXT10 sgRNA7-HXT9-11-12
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDR295
Plasmid#113874Purposeexpression of Cas9 programming sgRNA2 and sgRNA1 targetting GAL2 and HXT4-1-5/ HXT3-6-7 respectivelyDepositorInsertsgRNA2 GAL2 sgRNA1-HXT4-1-5;HXT3-6-7
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
KHBD00510
Plasmid#39611DepositorAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
KHBD00413
Plasmid#34520DepositorInsertCG8365 (E(spl)m8-HLH Fly)
UseGateway donor vectorAvailable SinceJan. 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJC2297 - pHR-TRE3G-hSpCas9-NLS-FLAG-2A-Thy1.1
Plasmid#250251PurposeExpression of Cas9 with Thy1.1 cell surface marker under a doxycycline responsive promoter. Requires additional expression of transactivator.DepositorInserthSpCas9
UseCRISPR and LentiviralTagsNLS-FLAG-2A-Thy1.1PromoterTRE3GAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIB-FLAG(N)-CDC73
Plasmid#231726PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIB-FLAG(N)-CDK12deltaCTD(1-1082)
Plasmid#231735PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIB-FLAG(N)-CDK12
Plasmid#231716PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIB-FLAG(N)-CDK13
Plasmid#231717PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIB-FLAG(N)-CDK9
Plasmid#231719PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdnCas3-CDA1
Plasmid#229535PurposepMV_hyg encoding dnCas3(H74A+D75A)-CDA1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsdnCas3
Cytidine deaminase
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdnCas3-APOBEC1
Plasmid#229537PurposepMV_hyg encoding dnCas3(H74A+D75A)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
dnCas3
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
L2088-Mut-GPA-NLuc-Biosensor-Retrovirus-TD138
Plasmid#222876PurposeRetroviral vector encoding biosensor chains to detect rapamycin (FRB/FKBP domains) and respond with split NanoLuciferase reconstitution (11S/114 fragment). Mixed WT/V84R Glycophorin A (GPA) scaffold.DepositorInsertFRB-GPA(V84R)-NanoLuc114-T2A-FKBP-GPA(WT)-NanoLuc11S
UseRetroviralTagsMycExpressionMammalianMutationFRB chain: V84R in GPAPromoterMSCV LTRAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1TMSNKRS
Plasmid#198323PurposetRNA synthetase/tRNA pair for the in vivo incorporation of N6-(((trimethylsilyl)methyl)carbamoyl)-L-lysine (TMSNK), into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
vPyACR_2164382
Plasmid#153029PurposeAnion-conducting channelrhodopsin of viral origin. Codon-optimized for mammalian expression (human/mouse).DepositorInsertvPyACR_2164382
TagseYFPExpressionMammalianMutationvPyACR_2164382 was C-terminally truncated to incl…PromoterCMV (+ enhancer)Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
vPyACR_21821
Plasmid#153030PurposeAnion-conducting channelrhodopsin of viral origin. Codon-optimized for mammalian expression (human/mouse).DepositorInsertvPyACR_21821
TagseYFPExpressionMammalianMutationvPyACR_21821 was C-terminally truncated to includ…PromoterCMV (+ enhancer)Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-XMod-Doc (BMB-KO, S199AzF)-HIS
Plasmid#153445PurposeE. coli expression (amber suppression) of Rc. XDocB binding mode B knock-out mutant with serine at position 199 replaced with amber codon.DepositorInsertRc.XDocB
Tags6xHis and ybbr tagExpressionBacterialMutationSerine 199 was mutated to amber codon (TAG). Argi…PromoterT7 promoterAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-XMod-Doc (BMA-KO, S199AzF)-HIS
Plasmid#153444PurposeE. coli expression (amber suppression) of Rc. XDocB binding mode A knock-out mutant with serine at position 199 replaced with amber codon.DepositorInsertRc.XDocB
Tags6xHis and ybbr tagExpressionBacterialMutationSerine 199 was mutated to amber codon (TAG). Argi…PromoterT7 promoterAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOUPc-Rh159-GFP
Plasmid#179280PurposeAll in one "tet-on" lentivirus vector that expresses rhesus cytomegalovirus Rh159 fused to an eGFP tag at its cytoplasmic tail. Rh159 is an ER resident protein that binds NKG2D activating ligands.DepositorInsertRh159 fused to eGFP
UseLentiviral; All-in-one "tet" on lentivi…TagseGFPExpressionMammalianPromoterTet Responsive Element 3GAvailabilityAcademic Institutions and Nonprofits only -
R701-X65-527: His6-tev-Hs.CALM1(2-148)
Plasmid#159693PurposeE. coli protein expression of His6-tev-Hs.CALM1(2-148)DepositorAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pATP416-ptetO7-pphlO6-crtYBI
Plasmid#165976PurposeExpresses carotenoid biosynthesis gene in response to 2,4-diacetylphloroglucinol and doxycycline in yeast expressing rtTA and PhlTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pphlO6), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
anxA2-GFP
Plasmid#107196PurposeExpresses human annexin A2-GFP fusion protein for live cell imagingDepositorInsertannexin A2 (ANXA2 Human)
TagsGreen Fluorescent ProteinExpressionMammalianMutationAla residue 65 in human sequence replaced by Glu …PromoterCMVAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
L4857 dsRedExpress2 reporter, VEGFR2 NTEVp, VEGFR1 CTEVp in PiggyBac Transposon Vector
Plasmid#244187PurposePiggyBac transposon vector for expression of dsRed-Express2 synTF promoter; constitutive expression of VEGFR2 NTEVp chain, VEGFR1 CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRed-Express2 under synTF responsive promoter; VEGFR2 NTEVp chain with WT NTEVp; VEGFR1 CTEVp chain; mNeonGreen-P2A-PuroR
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRE-8XGTIIC-DsRED-DD
Plasmid#115798Purposelentiviral, trimethoprim (TMP) regulated YAP promoter activity reporterDepositorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
LCV2_EGFP
Plasmid#155098PurposeLentiviral backbone for cloning and expression of U6 driven gRNAs with Esp3I/BsmBI cloning sites, puromycin selection and EGFP expressionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-SARS-CoV-2-S-RBD-sfGFP
Plasmid#141184PurposeMammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) fused with sfGFPDepositorHas ServiceCloning Grade DNAInsertS surface glycoprotein [ Severe acute respiratory syndrome coronavirus 2 ] (S SARS coronavirus 2)
TagsSignal peptide from influenza HA and Superfolder …ExpressionMammalianPromoterCMVAvailable SinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-PE2-P2A-BFP
Plasmid#231580PurposeExpresses the PE2 prime-editing machinery fused to BFP (PE2-P2A-BFP), under the control of a TRE3G promoter. This promoter is responsive to doxycycline bound to the rtTA proteinDepositorInsertPE2-P2A-BFP
UseLentiviralTagsP2A-BFPExpressionMammalianPromoterTRE3GAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-p300
Plasmid#191764PurposeExpression of EGFP fused to core p300 histone acetyltransferaseDepositorInsertFRB-EGFP-p300 core (EP300 Human)
TagsEGFP (N-terminal of p300 core) and FRB (N-termina…ExpressionBacterial and MammalianPromoterEF1alphaAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
p80-Katanin-mNeonGreen
Plasmid#191762PurposeExpression of mNeonGreen fused to p80-KataninDepositorInsertp80-Katanin-mNeonGreen (KATNB1 Human)
TagsmNeonGreenExpressionBacterial and MammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMG059 MBP-CREB-His
Plasmid#154076PurposeExpresses MBP-CREB-His (human CREB as a fusion protein with MBP and His- tags) in E.coliDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαs-LgB113
Plasmid#134362PurposeNanoluc complementation assay. Expression of Gαs protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 113 and 114 of Gαs. Addition of the HA epitope at N terminus of Gαs.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN114 - pCAGGS-Tir1-V5-BpA-Frt-PGK-EM7-PuroR-bpA-Frt-Rosa26
Plasmid#92143PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse Rosa26 locus using Puromycin selection. Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-AUP1-FLAG-DATDCUE
Plasmid#185340PurposeAssessing domain requirement sof AUP1DepositorInsertAUP1 (AUP1 Human)
TagsFLAG, 6xHisExpressionMammalianMutationdeletion of aa 90-337 corresponding to the acyl t…Available SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-AUP1-FLAG-DCUE
Plasmid#185339PurposeAssessing domain requirements of AUP1DepositorInsertAUP1 (AUP1 Human)
TagsFLAG, 6xHisExpressionMammalianMutationdeletion of aa 293-337 corresponding to the CUE d…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)GαsL-260-NLuc
Plasmid#207158PurposePart of REGA-SIGN, a NanoBRET-based G protein biosensor. It encodes long transcript variant of GNAS tagged with NanoLuciferase and is meant to be paired with Ggamma1 labeled with LSS-mKATE2DepositorAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)GαsS-246-Nluc
Plasmid#207157PurposePart of REGA-SIGN, a NanoBRET-based G protein biosensor. It encodes short transcript variant of GNAS tagged with NanoLuciferase and is meant to be paired with Ggamma1 labeled with LSS-mKATE2DepositorAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry
Plasmid#155096PurposeLentiviral backbone for cloning and expression of U6 driven gRNAs with Esp3I/BsmBI cloning sites, puromycin selection and mCherry expressionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only