We narrowed to 17,257 results for: form
-
Plasmid#134268PurposeLentivector encoding 3XHA-tagged GK5 (isoform 1)DepositorInsertGk5 (Gk5 Mouse)
UseLentiviralTags3X HAExpressionMammalianMutationmouse Gk5 isoform 1; 516 amino acidsPromoterCMVAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBOB-C-Flag-GK5_v2
Plasmid#134260PurposeLentivector encoding Flag-tagged GK5 (isoform 2)DepositorInsertGk5 (Gk5 Mouse)
UseLentiviralTagsFlagExpressionMammalianMutationmouse Gk5 isoform 2; 534 amino acidsPromoterCMVAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBOB-C-Flag-GK5_v1
Plasmid#134257PurposeLentivector encoding Flag-tagged GK5 (isoform 1)DepositorInsertGk5 (Gk5 Mouse)
UseLentiviralTagsFlagExpressionMammalianMutationmouse Gk5 isoform 1; 516 amino acidsPromoterCMVAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-1alpha
Plasmid#124155PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro)mEOS2 hYAP 1-1gamma
Plasmid#124157PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-1delta
Plasmid#124158PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-2alpha
Plasmid#124159PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-2beta
Plasmid#124160PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-2gamma
Plasmid#124161PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-1beta
Plasmid#124156PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO h-Stx3 L165A/E166A-2xMyc/His
Plasmid#99743PurposeExpresses human Stx3 locked into the open conformation with a C-term myc-myc-his tag in mammalian cells.DepositorInsertStx3 (STX3 Human)
Tagsmyc-myc-hisExpressionMammalianMutationChanged both L165 and E166 to AlaninePromoterCMVAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3 SIRT1-NTerm Exon1-Exon3
Plasmid#105681PurposeBacterial Expression construct of N terminus of SIRT1: Exon1-Exon3 (deltaExon2)DepositorInsertSIRT1-NTerm: Exon1-Exon3 (Sirt1 Mouse)
TagsGSTExpressionBacterialMutationSynonymous base changes not affecting the protein…Promotertac_PromoterAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3- SIRT1-NTerm Exon1-Exon2-Exon3
Plasmid#105680PurposeBacterial Expression construct of N terminus of SIRT1: Exon1-Exon2-Exon3DepositorInsertSIRT1-NTerm: Exon1-Exon2-Exon3 (Sirt1 Mouse)
TagsGSTExpressionBacterialMutationSynonymous base changes not affecting the protein…Promotertac_PromoterAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-RGS7t
Plasmid#55761PurposeAn amino-terminal CFP Fragment was fused to residues 202-477 of RGS7. When co-expressed with a carboxyl terminal fragment of CFP fused to Gbeta-5, a fluorescent signal is produced.DepositorInsertRGS7(202-477)-CFP(1-158) (RGS7 Aequorea victoria, Human)
TagsCFP(1-158) was fused to the amino terminus of RGS…ExpressionMammalianMutationThe RGS sequence amino terminal to the GGL domain…PromoterCMVAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTH748-CEN-RLuc/min8maxCFLuc
Plasmid#38214DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first eight codons of the original FLuc gene …PromoterADH1 and TDH3 (=GDP)Available SinceNov. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH747-CEN-RLuc/min4maxCFLuc
Plasmid#38213DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first four codons of the original FLuc gene w…PromoterADH1 and TDH3 (=GDP)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.HA.RUNX1C.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
Plasmid#181978PurposeHuman RUNX1C gene overexpressionDepositorAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AR-V7-pcw107
Plasmid#64635Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertAR (transcript variant 1, splice isoform) (AR Human)
UseLentiviralMutationsplice isoform*PromoterPGKAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pETDuet_huCAD_ICADL (TevS)
Plasmid#100098Purposedual expression of human CAD and ICAD. The two caspase cleavage sites in ICAD were mutated to TEVP cleavable sequencesDepositorExpressionBacterialMutationtwo caspase cleavage sites (DETD-117 and DAVD-224…PromoterT7Available SinceJan. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
PGL4.11-COL1A1WT
Plasmid#230915PurposeExpression of human COL1A1 promoter and testing the promoter activity with luciferase assay.DepositorInsertHuman COL1A1 promoter (COL1A1 Human)
UseLuciferaseTagsluciferase - Luc2pExpressionBacterial and MammalianPromoterCOL1A1Available SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cavbeta1 Ca2+ channel scFv [N7/18]
Plasmid#206789PurposeMammalian Expression of Cavbeta1 Ca2+ channel scFV. Derived from hybridoma N7/18 scFv.DepositorInsertCavbeta1 Ca2+ channel (Homo sapiens) recombinant scFV (CACNB1 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphai2-RLuc8
Plasmid#140974PurposeEncodes a G alpha subunit (GNAI2) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphai2-Rluc8 (GNAI2 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Anti-Bassoon [L124/59R]
Plasmid#177470PurposeMammalian Expression Plasmid of anti-Bassoon (Rat). Derived from hybridoma L124/59.DepositorInsertanti-Bassoon (Rattus norvegicus) recombinant mouse monoclonal antibody (Bsn Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 R62D actin-3XNLS P2A mCherry
Plasmid#58477PurposeExpresses nuclear-targeted non-polymerizing R62D mutant of human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsTagsmCherryExpressionMammalianMutationChanged Arginine 62 to Aspartic AcidPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 actin-3XNLS P2A mCherry
Plasmid#58475PurposeExpresses nuclear-targeted human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsTagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.2 EmGFP hAQP4(M23)
Plasmid#126464PurposeExpresses human AQP4 (isoform M23) as an EmGFP fusion protein in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
IP3 receptor, type 1 scFv [L24/21]
Plasmid#206790PurposeMammalian Expression of IP3 receptor, type 1 scFV. Derived from hybridoma L24/21 scFv.DepositorInsertIP3 receptor, type 1 (Rattus norvegicus) recombinant scFV (Itpr1 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 PA-PLA1 (EGFP-PA-PLA1)
Plasmid#162880PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with EGFPDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsEGFPExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cav1.2 Ca2+ channel scFv [N263/31]
Plasmid#182083PurposeMammalian Expression of Cav1.2 Ca2+ channel scFv. Derived from hybridoma N263/31.DepositorInsertrecombinant mouse scFv targeting Cav1.2 Ca2+ channel (Rattus norvegicus) (Cacna1c Mouse)
TagsHA, HisExpressionMammalianPromoterCMVAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
IP3 receptor, type 1 scFv [L24/1]
Plasmid#206755PurposeMammalian Expression of IP3 receptor, type 1 scFV. Derived from hybridoma L24/1 scFv.DepositorInsertIP3 receptor, type 1 (Rattus norvegicus) recombinant scFV (Itpr1 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-HAPLN1
Plasmid#200777PurposeExpresses full-length mouse HAPLN1 fused with cysteine-free GFP (cfGFP) under synapsin promoterDepositorHas ServiceAAV8InsertHyaluronan And Proteoglycan Link Protein 1 (Hapln1 Mouse)
UseAAVTagscfGFPPromoterSynapsinAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2234)
Plasmid#160628PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.DepositorInserttNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
UseCRISPRMutationBsaI and BsmBI sites removedPromoterPnos, 35S, 35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Prom1-TEVp-TwinStrep-His / IRES2 / Pcdh21-TEVp-Myc-Flag
Plasmid#210820PurposeMammalian overexpression vector for polycistronic co-expression of C-terminally Strep and His tagged human Prom1s1 (WT) and C-terminally Myc and Flag tagged human Pchd21 (WT)DepositorTagsMyc, 3xFlag and TwinStrep, 10xHisExpressionMammalianPromoterCMV and CMV / IRES2Available SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-∆Hapln1
Plasmid#200778PurposeExpresses mouse HAPLN1 mutant lacking the lectican binding domain and fused with cysteine-free GFP (cfGFP) under synapsin promoterDepositorHas ServiceAAV8InsertHyaluronan And Proteoglycan Link Protein 1 (Hapln1 Mouse)
UseAAVTagscfGFPMutationdeleted lectican binding domain (aminoacids 40-15…PromoterSynapsinAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Neuroligin-4* [N98/47R]
Plasmid#188168PurposeMammalian Expression Plasmid of anti-Neuroligin-4* (Mouse). Derived from hybridoma N98/47DepositorInsertanti-Neuroligin-4* (Mus musculus) recombinant mouse monoclonal antibody (Nlgn4l Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 WD40 (All deleted)
Plasmid#197455PurposeThe plasmid expresses delta WD40 deleted version of Myc-tagged FBW7 human isoform 1. WD40 All are deleted. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW& dimerization domain deleted.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdICAM1-ST3-His
Plasmid#210666PurposeExpression of the extracellular domain of human ICAM1 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human ICAM-1 fused to Spytag003 and Histag (ICAM1 Synthetic, Human)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7f-WPRE
Plasmid#104488PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the Syn promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV8, and AAV9InsertjGCaMP7f
UseAAVTagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterSynapsinAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSF-MCM3/5
Plasmid#116950PurposeExpresses human MCM3 and human MCM5DepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD86-ST3-His
Plasmid#210664PurposeExpression of the extracellular domain of human CD86 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human CD86 fused to Spytag003 and Histag (CD86 Human)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD80-ST3-His
Plasmid#210665PurposeExpression of the extracellular domain of human CD80 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human CD80 fused to Spytag003 and Histag (CD80 Human)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FlpO-bGHpA
Plasmid#51669PurposeCan be used to generate AAV virus that will express the FlpO recombinase gene in neurons from the synapsin promoter.DepositorHas ServiceAAV RetrogradeInsertFlpO recombinase gene
UseAAVExpressionMammalianPromoterhSyn1Available SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL.PPT.SFFV.HA.RUNX1A.IRES.eGFP
Plasmid#181979PurposeHuman RUNX1A gene overexpressionDepositorAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-mCherry-G12V-KRAS-IRES-Blast
Plasmid#153336PurposeLentiviral vector plasmid for integration and constitutive expression of mCherry fused to oncogenic G12V-KRAS in mammalian cellsDepositorAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19_T2A-H2B-mCitrine_loxP-hPGK-BSD-loxP
Plasmid#195503PurposeSOX17 donor plasmid to generate locus specific C-terminal integration of H2B-mCitrine into the human SOX17-locusDepositorInsertSOX17(Ex2)-T2A-H2B-mCitrine_loxP-hPGK-BSD-loxP_SOX17(3'UTR) (SOX17 Human)
UseCRISPR; Donor vectorTagsT2A-H2B-mCitrineExpressionMammalianAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDF-MCM4/6
Plasmid#116951PurposeExpresses human MCM4 and human MCM6DepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hGOLGA2-C-PEN2
Plasmid#183649PurposeLentiviral expression of a golgi-residential PEN2.DepositorAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only