We narrowed to 21,628 results for: ESC
-
Plasmid#155136PurposeExpresses N-terminally GFP- and HA-tagged E. coli GlpG D243G/L244G/F245G/M247G/S248G/M249G/A250G variant from pGEX 4P-1DepositorInsertGlpG (glpG Escherichia coli)
UseTagsGST and HAExpressionBacterialMutationD243G/L244G/F245G/M247G/S248G/M249G/A250GPromotertacAvailable sinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralTagsExpressionMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBOB-N-Flag-Snrnp40
Plasmid#134249PurposeLentivector encoding Flag-tagged Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AvicFP3
Plasmid#129506PurposeExpresses AvicFP3 constitutively in E. coli (most strains)DepositorInsertAvicFP3
UseTagsExpressionBacterialMutationPromotersynthetic constitutive (stationary phase) promote…Available sinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Human INPP5A
Plasmid#129587PurposeExpression of human INPP5A in bacteriaDepositorInsertType I inositol 5-phosphatase (INPP5A Human)
UseTagsMaltose binding proteinExpressionBacterialMutationPromoterAvailable sinceSept. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNH-TrxT-S18
Plasmid#127826PurposeProduction of recombinant human ribosomal protein S18DepositorInsertRPS18 (RPS18 Human)
UseTagsHis6 - Thioredoxin - TEVExpressionBacterialMutationPromoterT7Available sinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_UNK_G1
Plasmid#127118DepositorInsertgRNA UNK (UNK Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2[eb-Tc’bhsp-EGFP-2A-Cre;3xP3-gTc’v-SV40]
Plasmid#124068PurposeCRISPR/Cas mediated knock-in via non-homologous end-joining in Tribolium; bhsp drives EGFP expression; Dm-ebony for linearization; (Transformation plasmid; Black eye marker)DepositorInserteb-Tc’bhsp-EGFP-2A-Cre; 3xP3-gTc’v-SV40
UseCRISPR and Cre/LoxTagsExpressionInsectMutationPromoterbhsp68Available sinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK_P-GAP-LM_lacO-cP-AOX1-sAR
Plasmid#126745Purposeyeast plasmid overexpressing sLovA,CPR and LacI-Mit1ADDepositorInsertslovA,cpr
UseTags6xHisExpressionYeastMutationPromoterGAPAvailable sinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK_P-ICL1-LM_lacO-cP-AOX1-sAR
Plasmid#126744Purposeyeast plasmid overexpressing sLovA,CPR and LacI-Mit1ADDepositorInsertslovA,cpr
UseTags6xHisExpressionYeastMutationPromoterICL1Available sinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-9-3p
Plasmid#103748PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-9-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-9-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-92a-3p
Plasmid#103752PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-92a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-92a-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-548h-3p
Plasmid#103635PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-548h-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-548h-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-548h-5p
Plasmid#103636PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-548h-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-548h-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-548a-3p
Plasmid#103626PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-548a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-548a-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-548a-5p
Plasmid#103627PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-548a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-548a-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-548d-3p
Plasmid#103631PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-548d-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-548d-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-548d-5p
Plasmid#103632PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-548d-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-548d-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-514a-3p
Plasmid#103597PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-514a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-514a-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-514a-5p
Plasmid#103598PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-514a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-514a-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-519a-3p
Plasmid#103606PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-519a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-519a-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-509-3p
Plasmid#103590PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-509-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-509-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-4536-3p
Plasmid#103540PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-4536-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-4536-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-4536-5p
Plasmid#103541PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-4536-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-4536-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-450a-5p
Plasmid#103533PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-450a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-450a-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-376a-5p
Plasmid#103498PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-376a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-376a-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-376c-3p
Plasmid#103499PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-376c-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-376c-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-329-3p
Plasmid#103440PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-329-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-329-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-329-5p
Plasmid#103441PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-329-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-329-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-30c-5p
Plasmid#103415PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-30c-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-30c-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-3130-5p
Plasmid#103423PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-3130-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-3130-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-3158-3p
Plasmid#103428PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-3158-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-3158-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-3158-5p
Plasmid#103429PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-3158-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-3158-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-219a-5p
Plasmid#103360PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-219a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-219a-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-219b-3p
Plasmid#103361PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-219b-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-219b-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-218-1-3p
Plasmid#103356PurposeUsed to sense miRNA activity using fluorescence based tools. hsa_miR-218-1-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa_miR-218-1-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-194-3p
Plasmid#103309PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-194-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-194-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-194-5p
Plasmid#103310PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-194-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-194-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-181a-3p
Plasmid#103275PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-181a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-181a-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-181b-2-3p
Plasmid#103277PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-181b-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-181b-2-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-133a-5p
Plasmid#103222PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-133a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-133a-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-135a-3p
Plasmid#103226PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-135a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-135a-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1285-3p
Plasmid#103201PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1285-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1285-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1285-5p
Plasmid#103202PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1285-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1285-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-129-5p
Plasmid#103207PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-129-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-129-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1185-5p
Plasmid#103182PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1185-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1185-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-125b-2-3p
Plasmid#103190PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-125b-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-125b-2-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-105-3p
Plasmid#103169PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-105-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-105-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-3130-3p
Plasmid#103422PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-3130-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-3130-3p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-519a-5p
Plasmid#103607PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-519a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-519a-5p target
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only