We narrowed to 1,494 results for: U6 promoter
-
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJJF495_dpy-10_CDS_sg6
Plasmid#164268PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJF439.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRExpressionWormPromoterU6 promoter from W05B2.8Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
B52 (empty plasmid backbone to express 2 sgRNAs)
Plasmid#100708PurposeEmpty plasmid backbone to express 2 sgRNAs (use BbsI and BsmBI for cloning)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1
Plasmid#108098PurposeLentiviral expression plasmid of sgRNA with GFPDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for sgRNA expression and EFS promoter…Available SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ-mgU2-47-Mango II
Plasmid#127586PurposeExpresses mgU2-47-Mango II scaRNA from a mU6 promoterDepositorInsertmgU2-47 scaRNA with Mango II tag
ExpressionMammalianPromotermodified U6Available SinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIIS948-CXCR4
Plasmid#238213PurposeTasR tigRNA expression to target CXCR4 under U6 promoter in human cells.DepositorInserttigRNA
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Agam_695
Plasmid#176654PurposeExpression of sgRNA under An. gambiae U6-2 (AGAP013695) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ-5S-F30-Mango IV
Plasmid#127584PurposeExpresses 5S-F30-Mango IV rRNA from a mU6 promoterDepositorInsert5S rRNA with F30 folding scaffold and Mango IV tag
ExpressionMammalianPromotermodified U6Available SinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJY-RpABE
Plasmid#112872Purposebinary vector for ABE expression in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA cassette
UseCRISPRExpressionPlantAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AY22_pgRNA.R5.1
Plasmid#100294PurposeCCR5-targeting gRNA expression plasmidDepositorInsertgRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6 RNA Pol III promoter human snRNAAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPUR-hU6-Sirius-8XMS2-mU6-Sirius-8XPP7
Plasmid#121944PurposeCRISPR-Sirius plasmidDepositorInserthU6-Sirius-8XMS2-mU6-Sirius-8XPP7 Cassette
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6 promotersAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV sgRNA Expression Plasmid
Plasmid#174540PurposeContains restriction sites to clone in U6 promoter and sgRNA oligo. CMV-driven mCherry fluorescent marker.DepositorTypeEmpty backboneUseAAVTagsNoneExpressionMammalianPromoterCMVAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aalb_743
Plasmid#176676PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029743) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPbU6_hdhfr/yfcu_Cas9
Plasmid#216423PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter and the Cas9 nuclease for traditional CRISPR editing.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aaeg_774
Plasmid#176673PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017774) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.6
Plasmid#176652PurposeExpression of sgRNA under D. melanogaster U6-3 _(CR31539) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
SauCas9 EMX1-pegRNA
Plasmid#169857PurposeSauCas9 pegRNA for EMX1DepositorInsertSauCas9 EMX1-pegRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
SiC-V1
Plasmid#133041PurposeSiC-V1 vector with SpCas9 gene and dTomato reporter. sgRNA targeting a gene of interest can be cloned downstream of U6 promoter.DepositorInsertSpCas9
UseCRISPR and LentiviralTagsdTomatoAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ-5S-F30-Control
Plasmid#127582PurposeExpresses 5S-F30-Control rRNA from a mU6 promoterDepositorInsert5S rRNA with F30 folding scaffold
ExpressionMammalianPromotermodified U6Available SinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_TFRC_C (with mCherry)
Plasmid#72627PurposeExpresses two gRNAs targeting the TFRC promoterDepositorInsertgRNAs toward TFRC
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPbU6_hdhfr/yfcu
Plasmid#216422PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter for traditional CRISPR editing.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_A
Plasmid#72620PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_C
Plasmid#72622PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_UCA1
Plasmid#72628PurposeExpresses two gRNAs targeting the UCA1 promoterDepositorInsertgRNAs toward UCA1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Consensus
Plasmid#176678PurposeExpression of sgRNA under mosquito consensus U6 promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
AM77_pU6.Sa-gRNA.CLYBL
Plasmid#199237PurposeExpression construct encoding a S. aureus guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. aureus gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aalb_743
Plasmid#176662PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029743) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spy CCR5-pegRNA
Plasmid#169856PurposeSpyCas9-pegRNA for CCR5DepositorInsertSpy CCR5-pegRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Consensus
Plasmid#176664PurposeExpression of sgRNA under mosquito consensus U6 promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aaeg_774
Plasmid#176659PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017774) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEN_hUmiRc2
Plasmid#25747PurposeEntry vector for cloning miR30-based shRNA driven by human U6 promoter.DepositorTypeEmpty backboneUseEntry vectorAvailable SinceJuly 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
px552-sg-gria1-HT-SEP
Plasmid#187653PurposeContains HaloTag-SEP to be inserted into the NTD of Gria1 (via HITI) and single guide RNA to target Cas9 to Gria1 under control of the U6 promoter.DepositorInsertHaloTag-SEP donor
UseAAV and CRISPRTagsN/APromoterN/AAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Agam_695
Plasmid#176668PurposeExpression of sgRNA under An. gambiae U6-2 (AGAP013695) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9 EMX1-nicking sgRNA
Plasmid#169859PurposeSpyCas9 nicking sgRNA for EMX1DepositorInsertSpyCas9 EMX1-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_TFRC_B
Plasmid#72626PurposeExpresses two gRNAs targeting the TFRC promoterDepositorInsertgRNAs toward TFRC
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
SauCas9 EMX1-nicking sgRNA
Plasmid#169860PurposeSauCas9 nicking sgRNA for EMX1DepositorInsertSauCas9 EMX1-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_B
Plasmid#72621PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Spy EMX1-pegRNA
Plasmid#169855PurposeSpyCas9-pegRNA for EMX1DepositorInsertSpy EMX1-pegRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aalb_744
Plasmid#176663PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029744) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only