We narrowed to 11,980 results for: SOM
-
Plasmid#190271PurposeExpress RPS9 WT mouse gene transcriptionally fused with eGFP. eGFP is translated from IRES.DepositorInsertribosomal protein RPS9
TagsIRES-eGFPExpressionMammalianPromoterCAGGS-CMVAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRps9-D95N-IRES-GFP-HygR
Plasmid#190272PurposeExpress RPS9 D95N-mutant mouse gene transcriptionally fused with eGFP. eGFP is translated from IRES.DepositorInsertribosomal protein RPS9
TagsIRES-eGFPExpressionMammalianMutationD95NPromoterCAGGS-CMVAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRD438
Plasmid#168464PurposeFor the insertion pf NLS-mEos3.2-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mEos3.2-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPK-352
Plasmid#157922PurposepcDNA-CMV-PCYA-IRES-HO1-P2A-FD-P2A-FNRDepositorInsertstPcyA
IRES
HO1
FD
FNR
UseSynthetic Biology; OptogeneticsTagsMitochondrial Targeting Sequence, Mitochondrial T…ExpressionMammalianPromoterCMVAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
BtGRK2[D110A K220R]-mVenus
Plasmid#137779PurposeVisualization of GRK2DepositorInsertBovine GRK2[D110A K220R] (GRK2 Bovine)
ExpressionMammalianMutationD110A K220RPromoterCMVAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
HsGRK6[L66A E514A]-sYFP2
Plasmid#137781PurposeVisualization of GRK6DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBT3038
Plasmid#122545PurposeExpression of a C. elegan codon optimized florescent protein (CemOrange2) fused to a lysosomal related organelle localized gene (glo-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFUPI hT5Cyp-H126Q
Plasmid#80281PurposeExpresses human TRIM5 CypA fusion with H126Q mutation in CypADepositorUseLentiviralExpressionMammalianMutationH126Q mutation in CypAAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTag-BFP-C-h-Rab11a
Plasmid#79805PurposeExpress TagBFP labeled human Rab11a (GTPase located on recycling endosomal membranes).DepositorAvailable SinceJuly 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCXLE-hUL
Plasmid#27080PurposeIntegration-free (episomal) expression of human L-MYC and LIN28DepositorAvailable SinceMarch 10, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChroME2s-ST-P2A-H2B-mRuby3
Plasmid#170163PurposeCation channelrhodopsin ChroME2s targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorHas ServiceAAV1InsertChroME2s-P2A-H2B-mRuby3
UseAAVExpressionMammalianAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hOCT3/4-shp53-F
Plasmid#27077PurposeIntegration-free (episomal) expression of human OCT3/4 and shRNA against p53DepositorInsertOCT3/4 (POU5F1 Human)
ExpressionMammalianAvailable SinceFeb. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
pMSCV-RUNX1-4A
Plasmid#238534PurposeUsed for overexpression of human RUNX1 in mammalian cells. Contains mutations that prevent phosphorylation at some sites of the translated protein.DepositorInsertsUseLentiviralExpressionMammalianMutationS249A, S266A, T273A, S276APromoterMSCV and PGKAvailable SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
LAMP1-SBP-GFP
Plasmid#120172PurposeExpresses a chimera of LAMP1, SBP tag and GFP (fluorescent tag)DepositorInsertLysosomal-associated membrane protein 1 (Lamp1 Rat)
TagsSBP and eGFPExpressionMammalianPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-ASAP5-Kv2.1-WPRE
Plasmid#225707PurposePan-neuronal soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV1InsertASAP5-Kv2.1
UseAAVPromoterhuman synapsinAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTUM4
Plasmid#230905PurposePlasmid encoding four periplasmic folding helper proteins to boost the secretion of functional heterologous proteins in E. coliDepositorInsertsExpressionBacterialAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Dio-ASAP5-Kv2.1-WPRE
Plasmid#225708PurposeCre dependent soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV9InsertASAP5-Kv2.1
UseAAVPromoterEF1αAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP SNAP23
Plasmid#101914PurposeExpresses SNAP23 in mammalian cellsDepositorAvailable SinceOct. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-EGFP-NLS-P2AT2A-mCherry-PTS1
Plasmid#87828PurposeHigh-efficient mammalian expression vector for co-expression of EGFP-tagged and mCherry-tagged proteins using P2AT2A. NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsNLS
PTS1
TagsEGFP and mCherryExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mTagBFP2-FRB-Rab7
Plasmid#214273PurposeMammalian expression of mTagBFP2-FRB-Rab7 (late endosome marker)DepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GCaMP 6m-p2A-ChRmine-Kv2.1-WPRE
Plasmid#131004Purposebicistronic AAV vector to express GCaMP6m and soma-targeted ChRmine under the control of human Synapsin promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsKv2.1-HAPromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP SNAP47
Plasmid#101915PurposeExpresses SNAP47 in mammalian cellsDepositorAvailable SinceMarch 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
PMP34-mApple
Plasmid#214417PurposePeroxisome localization of PMP34 fused to mAppleDepositorAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-EGFP-NLS-P2A-mCherry-PTS1
Plasmid#87803PurposeMammalian expression vector template for co-expression of EGFP-tagged and mCherry-tagged proteins using P2A. NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsNLS
PTS1
TagsEGFP and mCherryExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTag-RFP-C-h-Rab11a
Plasmid#79806PurposeExpress TagRFP labeled human Rab11a (GTPase located on recycling endosomal membranes).DepositorAvailable SinceJuly 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Cep170 (Nigg PID200)
Plasmid#41150DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCK306
Plasmid#110544PurposerhaBAD, a rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteria.DepositorInsertsPrhaBAD
yfp
rhaS
ExpressionBacterialPromoterN/A, PrhaBAD, and kanR promoter (upstream of kanR…Available SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-Dlx-SynaptoTAG
Plasmid#210729PurposeAAV vector for mapping synaptic projections. GABAergic neuron-specific Dlx promoter expresses EGFP-Synaptobrevin-2 to label synaptic terminals and Palm-tdTomato to label neuronal soma and axons.DepositorInsertEGFP-Synaptobrevin-2, P2A, Palm-tdTomato (tdTomato with Palmitoylation sequence) (Vamp2 Synthetic, Rat)
UseAAVPromoterDlxAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn LAMP1-msGFP (JV012)
Plasmid#179728PurposeLentiviral expression of LAMP1-msGFP for use as a lysosomal markerDepositorInsertLAMP1 (Lamp1 Mouse)
UseLentiviralAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRibo-Sec-APEX2m
Plasmid#176844PurposeExpression of APEX2 in the periplasm from a codon-optimized gene (multi-copy episomal plasmid)DepositorInsertpRibo-Sec-APEX2m
UseInducibleExpressionBacterialPromoterpRibo, theophilline riboswitch inducible hsp60 pr…Available SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB80-KIF1A(1-365)-VVDfast-mVenus-SSPB(micro)_P2A_iLID-mCherry-RAB11
Plasmid#174644PurposeOptogenetic coupling of RAB11 to opto-kinesin to induce anterograde transport of recycling endosomesDepositorInsertKIF1A(1-365)-VVDfast-mVenus-SSPB(micro)-P2A-iLID-mCherry-RAB11
TagsVenus-SSPB and iLID-mCherryExpressionMammalianMutationmmKIF1A(aa1-365): Pro202Ala; mVenus: Met1Del, Thr…PromoterChicken beta-actinAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_CRATES
Plasmid#176251PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and type IIS restriction site for endonuclease BaeI at the crRNA region that facilitates the generation of mulitplDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
GST scFv [N100/13]
Plasmid#190521PurposeMammalian Expression of GST scFV. Derived from hybridoma N100/13.DepositorInsertGST (Schistosoma japonicum) recombinant scFV
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC150-KEIMA-VAPA
Plasmid#212096PurposeFluorescent reporter for VAPA clearance to acidic lysosomesDepositorAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-7guides-PGK-Puro
Plasmid#201960PurposeEBNA episome plasmid for U6 promoter-driven expression of 7 gRNAs targeting miRNA302/367. Includes PGK-puro selection cassetteDepositorInsertMIR302-7g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA228-pro4IUPi
Plasmid#122018PurposeExpresses IUP pathway genes (ChK, IPK, idi) under constitutive promoter. Kan. resist.DepositorInsertsExpressionBacterialMutationCodon optimized for E. coliPromoterpro4Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-LC3B G120A
Plasmid#123115PurposeExpresses EGFP-LC3B G120A in mammalian cells. Negative control fluorescent reporter, unable to localize to autophagosomes.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFPExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only