We narrowed to 16,444 results for: GRN
-
Plasmid#138189Purpose3rd generation lentiviral gRNA plasmid targeting human CDKN1ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pH-PABE-7-esgRNA
Plasmid#115620PurposeTargeted A to G in riceDepositorInsertwtTadA-TadA7.10-nCas9-3*NLS
UseCRISPRExpressionPlantAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTol2_NBT:Cas9green; erbb2_gRNA171
Plasmid#199337PurposepDEL134; transgenic construct to express cell-specific Cas9 in neurons; ubiquitous erbb2 sgRNADepositorInsertsNBT
Cas9
erbb2 sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Chr1q_Centromere-Targeting_gRNA
Plasmid#195125PurposegRNA targeting centromere-proximal location on Chromosome 1q in a third generation Cas9 backbone with GFPDepositorInsertChr1q gRNA
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-FRT
Plasmid#183241Purposeanhydrotetracycline (aTC) inducible sgRNA that targets FRT scar sites and arabinose inducible lambda RedDepositorInsertsgRNA-FRT
ExpressionBacterialPromoterP-tetAvailable SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH-STEME-NG-esgRNA
Plasmid#138136PurposeTargeted simultaneous C-to-T and A-to-G in riceDepositorInsertAPOBEC3A-wtTadA-TadA7.10-nCas9-NG-UGI-NLS
ExpressionPlantAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pY2ShHELIX_sgRNA_entry (CJT30)
Plasmid#181781PurposeExpresses Y2-ShHELIX containing a nicking Y2 I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertY2-nAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
ExpressionBacterialMutationY2-nAniI = F13Y, S111Y, K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-1
Plasmid#164858PurposeConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-1
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
AV15_pCAG.Cas9.gRNA.S1
Plasmid#199259PurposeExpression construct encoding SpCas9 nuclease and an AAVS1-targeting guide RNADepositorInsertsSpCas9 nuclease
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPgiCas13b-gRNA-1
Plasmid#184834PurposeConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for PgiCas13b in bacteria.DepositorInsertConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for PgiCas13b in bacteria.
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPgiCas13b-gRNA-NT
Plasmid#184835PurposeConstitutive expression of single-spacer CRISPR array with non-targeting spacer for PgiCas13b in bacteria.DepositorInsertConstitutive expression of single-spacer CRISPR array with a nontargeting spacer for PgiCas13b in bacteria.
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-NT
Plasmid#184838PurposeExpression of single-spacer CRISPR array with a shortened non-targeting spacer for PbuCas13b and expression of PbuCas13b in bacteria.DepositorInsertCo-expression of single-spacer CRISPR array with a nontargeting spacer for PbuCas13b and PbuCas13b nuclease in bacteria.
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-rssA
Plasmid#89957PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting rssA.DepositorInsertrssA gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMPTY::sgRNA2
Plasmid#165459PurposeEscherichia coli – Staphylococcus aureus shuttle vector for plasmid curing in Gram-positive bacteriaDepositorInsertsgRNA2
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterSP01Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEX-A-U6-gRNA
Plasmid#65626PurposeEmpty vector for the expression U6 driven gRNADepositorInsertU6-gRNA
Available SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA(tyr)
Plasmid#64250Purposeexpresses sgRNA(tyr) under U6a promoterDepositorInsertU6a:sgRNA (tyr)
UseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEX128·gRNA
Plasmid#187600PurposeTemplate for amplification of gRNA with Cas6 recognition siteDepositorInsertgRNA template
Promoterno promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUC19-gRNA
Plasmid#137776PurposeContains the T7 promoter and gRNA scaffold and is used for the in vitro transcription of gRNAsDepositorInsertgRNA scaffold
UseCRISPRMutationpUC19 BsaI destroyedPromoterT7Available SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSCB2-sgRNA
Plasmid#129463PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).DepositorInsertpgRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only