We narrowed to 24,135 results for: CRISPR
-
Plasmid#227308PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of COX8A for knock-in.DepositorInsertsgRNA Targeting C-terminus of COX8A (COX8A Human)
UseCRISPRExpressionMammalianPromoterU67Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRExpressionMammalianPromoterchick U6.3Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ACTB
Plasmid#207748PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of ACTB for knock-in.DepositorAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLD037-pCMV-APOBEC-Cas9(D10A)-rXRCC1
Plasmid#165444PurposeExpresses ACX, rXRCC1 in mammalian cellsDepositorInsertAPOBEC-nCas9-rXRCC1 (Apobec1 Rat, Streptococcus pyogenes, Synthetic)
ExpressionMammalianAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
SunTag-FWAgRNA-4-22aa-TET1cd
Plasmid#106435PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the FWA promoterDepositorInsertgRNA4_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno EA
Plasmid#64071PurposeAdenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4DepositorInsertU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
UseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
HP-Cas9hGem-Ade2-LEU2-LINEAR
Plasmid#174839PurposepRS414 backbone containing LINEAR fragment targeting ADE2 in H. polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoterTDH3pAvailable SinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7558 pHR (hU6-crB2M-EFS-PuroR-WPRE)
Plasmid#214881PurposeLentiviral vector encoding RfxCas13d targeting B2M guideDepositorInserthU6-crB2M-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA364
Plasmid#215956PurposeFragmid fragment: (guide cassette) epegRNA expressionDepositorHas ServiceCloning Grade DNAInsertdU6:3_v1; BsmBI_v14; BsmBI_v15; evopreQ1_v1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cas12j-8-puro-crRNA
Plasmid#194965PurposeThe plasmid expresses human codon-optimized Cas12j-8, crRNA expression elements and puromycin resistence gene.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pY30
Plasmid#84745PurposeExpresses huAsCpf1-P2A-puro and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
Tags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRG01-U6-DR-crRNA-BsmbI(x2)-6T; EFS-Puro-2A-Fluc-WPRE
Plasmid#123362PurposeLentiviral vector with empty U6 cassette containing LbCpf1 direct repeat and U6 terminator, with constitutive expression of puromycin resistance and Firefly luciferase.DepositorInsertFirefly luciferase
UseCRISPR, Lentiviral, and LuciferaseExpressionMammalianPromoterEFSAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Blast-ARL13B
Plasmid#227278PurposeDonor template for mStayGold-EFS-Blast insertion into the C-terminus of the ARL13B locus. For cilia visualization. To be co-transfected with plasmid pX330-PITCh-ARL13B (Addgene #227276)DepositorInsertARL13B Homology Arms flanking a mStayGold-EFS-Blast Cassette (ARL13B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHS71_10xHis_MBP_TEV_WT-Cas9_2xNLS
Plasmid#244833PurposeBacterial expression of SpyCas9 (WT) with 2xSV40 nuclear localization sequence for protein purificationDepositorInsertSpyCas9 (WT)
UseCRISPRTags10xHis-MBP and 2xSV40 NLSExpressionBacterialPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDonor-GDH
Plasmid#140629PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 and T7-GDH cargo gene.DepositorInsertMini-Tn6677, T7lac-GDH gene cassette
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Puro_siKO-2TO
Plasmid#86697PurposeTetracycline inducible (2TO version) expression of guide RNA targeted to AAVS1 locusDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterH1 2TOAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-FRT
Plasmid#113398Purposeexpresses gRNA for Cas9 FRT targettingDepositorInsertexo, beta, gam, sgRNA-FRT
UseCRISPRExpressionBacterialAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-LAMP1
Plasmid#227322PurposeDonor template for mStayGold insertion into the C-terminus of the LAMP1 locus. For lysosome visualization. To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a mStayGold Tag (LAMP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
SECURE miniABEmax-K20A/R21A (pJUL1774)
Plasmid#131312PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with K20A/R21A mutations).DepositorInsertbpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-dTAG-LMNB1
Plasmid#207776PurposeDonor template for Blast-2A-dTAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-dTAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJZC74
Plasmid#62342PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-mRFP-; HE1A:BFP -0
Plasmid#180007PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-mRFP; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; HE1A:BFP -2
Plasmid#180012PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330 PLIN2
Plasmid#202196PurposepX330 backbone expressing sgRNA to edit the C-terminus of human PLIN2DepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTarget
Plasmid#214052PurposeExpresses target sequence for Haliangium type III CRISPR-Cas complex; identical to pNon-target (Addgene plasmid # 214053) but contains a protospacer.DepositorInsertTarget sequence
UseTarget rna plasmidExpressionBacterialPromotertrc promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNon-target
Plasmid#214053PurposeExpresses non-target sequence for Haliangium type III CRISPR-Cas complex; identical to pTarget (Addgene plasmid # 214052) but does not contain a protospacer.DepositorInsertNon-target sequence
UseNon-target rna plasmidExpressionBacterialPromotertrc promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -