We narrowed to 5,988 results for: crispr cas9 expression plasmids
-
Plasmid#184910PurposeTemplate to generate via PCR a single gRNA for expression in S. cerevisiaeDepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA
Plasmid#47108PurposeExpresses a S. pyogenes Cas9/dCas9 guide RNA in mammalian cellsDepositorHas ServiceCloning Grade DNAInsertSPgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCASB
Plasmid#190175PurposePlasmid for yeast expression of Cas9; contains a golden gate cloning site to additionally express a gRNA for a target sequenceDepositorInsertsgRNA cloning site
UseTagsExpressionBacterial and YeastMutationAdded 5'-agagacc-3' upstream and 5'…PromoterAvailable sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpG-P2A-mScarlet (MNW006)
Plasmid#174136PurposeCMV and T7 promoter expression plasmid for human codon optimized SpG(D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-mScarletDepositorInserthuman codon optimized SpG with BPNLS-3xFLAG-P2A-mScarlet
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-mScarletExpressionMammalianMutationSpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterCMV and T7Available sinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
tdTomato/pTREX-b
Plasmid#68709PurposeExpresses tdTomato in pTREX-b vector which confers resistance to blasticidin. This vector is used for cloning a specific sgRNA by BamHI, to transfect Cas9-expressing Trypanosoma cruzi epimastigotes.DepositorInserttdTomato
UseExpression of tdtomato red fluorescence protein i…TagsExpressionMutationPromoterAvailable sinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-MBP-Geo_st
Plasmid#87700PurposeExpression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBPDepositorInsertGeoCas9
UseTags10xHis-MBP-TEVExpressionBacterialMutationPromoterAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat
Plasmid#232100PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNW3
Plasmid#53372PurposeCsy4 and Cas9 D10A nickase expression plasmidDepositorInsertCsy4-T2A-Cas9n (D10A)
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable sinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_pNeurog2-Luciferase reporter
Plasmid#64160PurposePhotoactivatable transcription system. Mammalian expression of sgRNA1 to target pNeurog2-Luciferase reporter.DepositorInsertsgRNA1 for pNeurog2-Luciferase reporter
UseCRISPRTagsExpressionMammalianMutationPromoterhuman U6Available sinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1-BFP
Plasmid#120577PurposeLentiviral plasmid to co-express a guide RNA and EBFP.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-Puro-ccdB
Plasmid#82580PurposeA modified version of plasmid pX330 (#42230): Added are a ccdB stuffer and a Puromycin selection cassetteDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterCBhAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSF511
Plasmid#222719PurposeCRISPR/Cas9 plasmid with gRNA1 for site gsdA, Cas9DepositorArticleInsertgRNA1(gsdA)
UseCRISPR; A. nigerTagsExpressionBacterialMutationPromoterpmbfAAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGRB
Plasmid#71539Purposefor expression of gRNA in E. coliDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterJ231196Available sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2
Plasmid#50590PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, U626t plus, U629p, T2
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT3T4
Plasmid#50592PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT3, gRNA scaffold, U6-1tplus, U6-26p, T4
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT1T2
Plasmid#50593PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, gRNA scaffold, OsU3t plus, TaU3p, T2
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT3T4
Plasmid#50595PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT3, gRNA scaffold, U6-26t plus, OsU3p, T4
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSGKP-km
Plasmid#117233PurposeA sgRNA expression plasmid for genome editing in Klebsiella PneumoniaeDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT2T3
Plasmid#50591PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT2, gRNA scaffold, U6-29t plus, U6-1p, T3
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSGKP-spe
Plasmid#117234PurposeA sgRNA expression plasmid for genome editing in Klebsiella PneumoniaeDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRCC-K
Plasmid#81191PurposeExpression of Cas9 and gRNA cassette in S. cerevisiae; Kan ResistanceDepositorInsertsCas9
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease see depositor comments below. and WT - cod…PromoterROX3 and SNP52pAvailable sinceSept. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRCC-N
Plasmid#81192PurposeExpression of Cas9 and gRNA cassette in S. cerevisiae; Nourseothricin ResistanceDepositorInsertsCas9
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease see depositor comments below. and WT - cod…PromoterROX3 and SNP52pAvailable sinceSept. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT2T3
Plasmid#50594PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT2, gRNA scaffold, TaU3t plus, U6-26p, T3
UseCRISPR; Pcr templateTagsExpressionPlantMutationPromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRISPomyces-1
Plasmid#61736PurposeStreptomyces expression of codon-optimized Cas9, tracrRNA, and custom crRNADepositorInsertssSpCas9
tracrRNA
crRNA cassette
UseCRISPRTagsExpressionBacterialMutationBbsI-flanked lacZ cassette inserted in place of s…Promotergapdhp(EL), rpsLp(CF), and rpsLp(XC)-BbsIAvailable sinceJan. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
APq5210
Plasmid#66086Purposeco-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORFDepositorInsertsgRNA for APa4-2
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
AP303-4
Plasmid#66088Purposeco-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2DepositorInsertsgRNA for APs1
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP334-5
Plasmid#66096Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs5
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
APq5271
Plasmid#66085Purposeco-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORFDepositorInsertsgRNA for APa4-2
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
APCSD 54
Plasmid#66100Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans swan-2DepositorInsertsgRNA for CSD 54
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
APCSD 53
Plasmid#66099Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans swan-2DepositorInsertsgRNA for CSD 53
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP334-6
Plasmid#66097Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs5
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP334-2
Plasmid#66095Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs5
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP324-4
Plasmid#66094Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs6
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP324-3
Plasmid#66093Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs6
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP324-2
Plasmid#66092Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs6
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only