We narrowed to 3,402 results for: aaas
-
Plasmid#90568Purpose3rd generation lentiviral gRNA plasmid targeting human CBX3DepositorInsertCBX3 (Guide Designation A5.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Dnmt3b-R
Plasmid#122333PurposeExpresses sgRNA targeting mouse Dnmt3b and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Dnmt3b
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EZH2_2
Plasmid#36388DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
EZH2 E9.3 gRNA
Plasmid#90684Purpose3rd generation lentiviral gRNA plasmid targeting human EZH2DepositorInsertEZH2 (Guide Designation E9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Kmt5cFL-CatMut
Plasmid#235590PurposeDox-inducible expression of control catalytic-mutant Kmt5c CD fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 shFmnl2-EGFP
Plasmid#187255PurposeLentiviral expression of shRNA targeting Fmnl2DepositorAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-memRFP-3xControlgRNA
Plasmid#224567PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and membrane RFP reporter.DepositorInsertmRFP1
UseCRISPRTagsMembrane localization signalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCAS9 wt (BB)-2A-GFP targeting human TRIM21
Plasmid#138295PurposegRNA for CRISPR/Cas9 knockout of human TRIM21DepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P81nmt1
Plasmid#39282DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…Mutation-1163 to +6 of nmt1 locus with a 7bp deletion (AT…Available SinceSept. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
Rescue Septin 11 mRNA
Plasmid#122022PurposeRescue mRNA for Septin 11 Knock Down with sh1 shRNA. Splice variant II (EU711415) with 5 silent mutations at the SEPT11 sh1 shRNA target site.DepositorInsertSEPT11 (Sept11 Rat)
ExpressionMammalianMutationSilent mutations are in 5 consecutive codons (AUU…Available SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P81nmt1-3HA
Plasmid#39285DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTags3xHA, A. gossypii translation elongation factor 1…Mutation-1163 to +6 of nmt1 locus with a 7bp deletion (AT…Available SinceAug. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBS NL4-3 envFS eGFP 5'CMV Δtat ΔTARx2_d2TetOp
Plasmid#101349Purpose2xTet Operator inserted between NFkB and Sp1 sites in U3 of HIV-1 delta tat with 5' CMV-R-U5. 5' and 3' TAR elements were mutated to: 5'-GGTCTCTCTGGTTAGACCAGAAAGGAGCATTGGAGCTCTCTGGCTAACTAGGGAACCC-3DepositorInsertNL4-3
UseLentiviralMutationdelta tat delta TAR delta env GFP in Nef Tet ope…Available SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-mCherry-SPASTIN
Plasmid#180647PurposeLentiviral expression vector for SPASTIN. Used for generating cell lines. Has N-terminal mCherry tag. SPASTIN starts on M87. Dox-inducible. Internal ID: WISP20-43.DepositorInsertSPASTIN
UseLentiviralTagsmCherryExpressionMammalianMutationStarts at M87, has siRNA resistance to GAACAGUGUG…Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
KIF20A D5.2 gRNA
Plasmid#90718Purpose3rd generation lentiviral gRNA plasmid targeting human KIF20ADepositorInsertKIF20A (Guide Designation D5.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.shHmga2
Plasmid#32399DepositorAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 U6-SaDMDR7-U6-SaDMDL2
Plasmid#78603PurposeAAV vector containing gRNAs (for SaCas9) targeting Dmd introns 22 and 23DepositorInsertU6-SaDMDR7-U6-SaDMDL2
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_UQCRC2
Plasmid#177982Purposelentiviral vector expressing Cas9 and a sgRNA targeting UQCRC2DepositorInsertsgRNA targeting UQCRC2 (UQCRC2 Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-GFPg1 (BB09)
Plasmid#139461PurposeLentiviral vector with gRNA targeting GFP; includes puromycin selectable markerDepositorInsertGFP-targeting sgRNA inserted; resistance gene: puroR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Bmi1_3
Plasmid#36354DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
Luciferase-pcw107
Plasmid#64648Purpose(control) when used to produce lentivirus, express physiological levels of insertDepositorInsertn/a
UseLentiviralPromoterPGKAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-CTRLg2
Plasmid#139451PurposeLentiviral vector with non-targeting gRNA and neomycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
LIN52 D6.4 gRNA
Plasmid#90735Purpose3rd generation lentiviral gRNA plasmid targeting human LIN52DepositorInsertLIN52 (Guide Designation D6.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EZH1_2
Plasmid#36360DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Ptpn23-g1)-PGKpuroBFP-W
Plasmid#105034PurposeLentiviral gRNA plasmid targeting mouse Ptpn23 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB3051(gRNA X-3 XI-2 XII-2)
Plasmid#73293PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-3, XI-2, and XII-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_Dual_pegRNA
Plasmid#173200PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 pegRNA with a user-specified pegRNA from two independent U6 promoters. pU6-pegRNA-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS186
Plasmid#140627PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS186. The crRNA-IS186 targets IS186 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS186
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLK1 G5.1 gRNA
Plasmid#90834Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorInsertPLK1 (Guide Designation G5.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-CTCF-prom
Plasmid#195104PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer10-UBC9-sh4
Plasmid#168988PurposeExpresses RFP cDNA and UBC9 shRNA 4 in mammalian cellsDepositorInsertUbiquitin Conjugating Enzyme 9
ExpressionMammalianPromoterUbc promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
HcRed-pcw107-V5
Plasmid#64647Purpose(control) when used to produce lentivirus, express physiological levels of insertDepositorInsertn/a
UseLentiviralTagsV5PromoterPGKAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
plKO.1-DNAJC5-ShRNA
Plasmid#205729PurposeKnockdown of DNAJC5DepositorInsertshRNA targeting DNAJC5 (DNAJC5 Human)
UseLentiviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJG367
Plasmid#91185PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, H840A double nickase (nAtCas9_H840A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_H840A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJG382
Plasmid#91189PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, D10A double nickase (nAtCas9_D10A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_D10A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_multi1-3-MS2-Puro
Plasmid#192683PurposeLentiviral expression of multi gNAs targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNAs #1,2,3 (MYOD1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EED_2
Plasmid#36386DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR/U6 HDAC5 shRNA
Plasmid#32222DepositorAvailable SinceSept. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherry
Plasmid#84260PurposeExpresses Sp sgSV40 gRNA with ABA-inducible KRAB and mCherry for diametric regulationDepositorInsertsSp sgSV40
PYL1-KRAB
UseCRISPR and LentiviralTagsIRES-mCherry and PYL1ExpressionMammalianPromoterCMV and mouse U6Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only