We narrowed to 4,849 results for: U6...
-
Plasmid#92353PurposeExpression plasmid for human codon-optimized wild-type SpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFlag-NLS-wild-type SpCas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationPromoterCbhAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pDECKO-mCherry TFRC_B
Plasmid#78544PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralTagsExpressionMammalianMutationPromoterU6 and U6 (for expressing sgRNA)Available sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-2
Plasmid#121423PurposesgYAP-2 sequence: GAGATGACTTCCTGAACAGTG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-2
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPcrRNA_Eco
Plasmid#106276PurposeE.coli CRISPR Type I-E crRNA cloning vector for mammalian expression driven by U6 promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pDECKO-mCherry MALAT1_Exon.2
Plasmid#78541PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralTagsExpressionMammalianMutationPromoterU6 (for expressing sgRNA) and U6 promoterAvailable sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.4
Plasmid#78543PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralTagsExpressionMammalianMutationPromoterU6 and U6 (for expressing sgRNA)Available sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available sinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med6_C_terminal
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorInsertMed6 (Med6 Mouse)
UseTagsExpressionMammalianMutationPromoterU6Available sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKSB-AeU6-1gRNA
Plasmid#183912PurposegRNA-expressing plasmid under Aedes aegypti AAEL017702 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
UseTagsExpressionMutationPromoterAedes aegypti U6 promoter (AAEL017702)Available sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKSB-AeU6-2gRNA
Plasmid#183913PurposegRNA-expressing plasmid under Aedres aegypti AAEL017774 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
UseTagsExpressionMutationPromoterAedes aegypti U6 promoter (AAEL017774)Available sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_EBFP_Nick_Dual_sgRNA
Plasmid#178094PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and EBFP Nick sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + EBFP nick sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_EGFP_Nick_Dual_sgRNA
Plasmid#178095PurposeControl vector for coselection for PE3b in human cells. Tandem expression of ATP1A1 G3 and EGFP Nick sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + EGFP nick sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178096PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178099PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_F2108L_Dual_pegRNA
Plasmid#178102PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-F2108L pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-F2108L pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_I2017T_Dual_pegRNA
Plasmid#178103PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178105PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only