We narrowed to 11,061 results for: AGA
-
Plasmid#199760PurposeElongation reporter construct to quantify elongation duration of 6_CGA stallingDepositorInsertsynYFP[TTG/AGA]-6xArg[CGA]-nLuc
ExpressionYeastPromoterTetO7Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-BLM DM
Plasmid#80071PurposeExpression of a sumo-mutant form GFP-BLM with K317R and K331R sumo-site mutationsDepositorInsertBLM (BLM Human)
TagsGFP-BLMExpressionMammalianMutationK317R (AAA>AGA) and K331R (AAA>AGA)Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T_CIP2A_1-560_R522D
Plasmid#217923PurposeE. coli expression of GST-tagged CIP2A_1-560 with R522D mutationDepositorAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 DPC4 (1-514)
Plasmid#14040DepositorInsertDPC4 (1-514) (SMAD4 Human)
ExpressionMammalianMutationR515 was mutated into a stop codon. AGA to TGA. D…Available SinceMay 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
pFA3
Plasmid#46790PurposeTo express ATPase inactive Fun30 in budding yeastDepositorInsertFUN30 (FUN30 Budding Yeast)
TagsV5ExpressionYeastMutationATP-binding site mutated replaced lysin 603 by ar…PromoterPGAL1Available SinceAug. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh10.1 GFP
Plasmid#209101PurposeGFP expressing shRNA targeting Cdh10DepositorInsertshCdh10.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCtnnd2.2-GFP
Plasmid#209097PurposeGFP expressing shRNA targeting Ctnnd2 3' UTRDepositorInsertshCtnnd2.2
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
MYMH 63
Plasmid#138046PurposeEncodes Ribosome Binding Site (RBS) variant using GFP as a reporter geneDepositorInsertpSEVA-331Bb-11AG-GFP
ExpressionBacterialMutationAAA GAG GAG AGAAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
MYMH 11
Plasmid#138020PurposeEncodes Ribosome Binding Site (RBS) variant using GFP as a reporter geneDepositorInsertpSEVA-331Bb-2AG-GFP
ExpressionBacterialMutationAGA GAG GAG AAAAvailable SinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Pmyo-3::hpo-30 gDNA (pBAB204)
Plasmid#117385PurposeAllows for body-wall muscle expression of HPO-30DepositorInsertgenomic DNA of hpo-30 (833 bp)
ExpressionWormAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFlare9A-Clip2E9 Mutant
Plasmid#209575Purposeminigene construct for Clip2 E9 alternative splicing, potential PTBP2 binding sites are deletedDepositorInsertClip2 (Clip2 Mouse)
ExpressionMammalianMutationACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTG…PromoterCMVAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-SF3B1-NTerm
Plasmid#97425PurposeExpresses human SF3B1 (AA 1-500) with N-term GST tag for inducible expression in E.coliDepositorInsertSF3B1-N-term (AA1-500)
TagsGSTExpressionBacterialMutationSilent mutation at nt876, aa289 (AGG to AGA)PromotertacAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
FHp5pUP95C3,5SGW (E5)
Plasmid#74035Purposelentiviral expression of Psd95 shRNA and Psd95-C3,5S-EGFP fusionDepositorInsertPsd95
UseLentiviral and RNAiExpressionMammalianMutationPCR: C3,5S (tct aga cca cca tgg act Ctc tAt CGa t…PromoterH1Available SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Satb2 sesRNA-2a-msFlag-2a-tTA-WPRE
Plasmid#239028PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUCsRNAP
Plasmid#182746PurposeSwapping in small RNA promoter, 23-bp spacer sequence, & 19-bp repeats into pJC005 plasmidsDepositorInsertsmall RNA promoter, a 23-bp spacer sequence, & 19-bp repeats
UseCRISPRAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRA03
Plasmid#103141PurposeTriple gRNA expression separated with 28nt Csy4 motifDepositorInsertgRNAs
ExpressionYeastAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7535 pHR (hU6-crSURF2-EFS-PuroR-WPRE)
Plasmid#214879PurposeLentiviral vector encoding RfxCas13d targeting SURF2 guide arrayDepositorInserthU6-crSURF2-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTC362
Plasmid#91216Purposeprotoplast vector for targeted deletion of 6 genes in tomatoDepositorInsertgRNAs targeting 6 tomato genes
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-42_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211682PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-42 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pED7x26
Plasmid#134813PurposeStringent phage propagation reporter containing pIII-16-29-34-TAGADepositorInsertpIII 16-TAGA 29-TAGA 34-TAGA
UseSynthetic BiologyExpressionBacterialMutation16-TAGA 29-TAGA 34-TAGAAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK01_Rho_minprox_DsREd
Plasmid#173489PurposePCR template for reporter gene with mouse Rhodopsin promoter with DsRedDepositorInsertMouse Rhodopsin promoter driving DsRed reporter gene
ExpressionMammalianPromoterMouse RhodopsinAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PDGFRb-IRES2-EGFP
Plasmid#204354PurposeExpresses wild-type PDGFRb gene.DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1050K (firefly luciferase)
Plasmid#132422Purposeexpress arrays of gRNA targeting Firefly Luciferase under dU6-3 promoterDepositorInsertfirefly Luciferase gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-PDGFRb-HA
Plasmid#204350PurposeExpresses wild-type PDGFRb gene. Used for DNA delivery using Adeno-associated Virus.DepositorAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PDGFRb559-562del-IRES2-EGFP
Plasmid#204355PurposeExpresses a mutant PDGFRb gene (559-562 deletion).DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
Mutation559-562 deletionAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-PDGFRb559-562del-HA
Plasmid#204351PurposeExpresses a mutant PDGFRb gene (559-562 deletion). Used for DNA delivery using Adeno-associated Virus.DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
UseAAVTagsHAMutation559-562 deletionAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfPENK-0.9k-Venus-WPRE
Plasmid#156401PurposeExpresses Venus under PENK gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfSST-0.3k-Venus-WPRE
Plasmid#156393PurposeExpresses Venus under SST gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfCCK-0.5k-Venus-WPRE
Plasmid#156392PurposeExpresses Venus under CCK gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.643
Plasmid#105565Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfvAChT-1.8k-Venus-WPRE
Plasmid#156389PurposeExpresses Venus under vAChT gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfPV-0.8k-Venus-WPRE
Plasmid#156399PurposeExpresses Venus under PV gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfPENK-2.2k-Venus-WPRE
Plasmid#156400PurposeExpresses Venus under PENK gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfSERT-1.9k-Venus-WPRE
Plasmid#156394PurposeExpresses Venus under SERT gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfPV-1.8k-Venus-WPRE
Plasmid#156398PurposeExpresses Venus under PV gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfSP-0.8k-Venus-WPRE
Plasmid#156397PurposeExpresses Venus under SP gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfSP-1.7k-Venus-WPRE
Plasmid#156396PurposeExpresses Venus under SP gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfSERT-0.5k-Venus-WPRE
Plasmid#156395PurposeExpresses Venus under SERT gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfvAChT-1.1k-Venus-WPRE
Plasmid#156390PurposeExpresses Venus under vAChT gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfCCK-3.9k-Venus-WPRE
Plasmid#156391PurposeExpresses Venus under CCK gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUDE735
Plasmid#103024Purposeexpression of a Cpf1 programming crRNA targetting CAN1, HIS4, PDR12 and ADE2 (crCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S)DepositorInsertcrCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S
UseCRISPRExpressionYeastPromoterSNR52Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-11mer-35kb-DSF-1-11
Plasmid#227489Purpose11-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode2
Plasmid#229063PurposeExpression mappingDepositorInsertCAG Barcode2
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
px459-AMBRA1 #3
Plasmid#172606PurposeExpresses gRNA #3 against AMBRA1 and Cas9 from S. pyogenes with 2A-PuroDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458-AMBRA1 #3
Plasmid#172607PurposeExpresses gRNA #3 against AMBRA1 and Cas9 from S. pyogenes with 2A-EGFPDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
EMX1_sgRNA
Plasmid#100555PurposeExpresses EMX1 sgRNA. Target sequence: GAGTCCGAGCAGAAGAAGAADepositorInsertEMX1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only