We narrowed to 15,268 results for: grn
-
Plasmid#70183PurposeInducible expression of guide RNA with fluorescent GFP reporterDepositorInsertH1-Tet-sgrna cassette
UseCRISPR and LentiviralExpressionMammalianAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLQ1651-sgTelomere(F+E)
Plasmid#51024PurposeLentiviral vector that contains an optimized S. pyogenes sgRNA targeting human telomeresDepositorInsertOptimized sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6 promoterAvailable sinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6a:sgRNA#2
Plasmid#64246Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX552
Plasmid#60958PurposepAAV-U6sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). AAV plasmid for sgRNA cloning. GFP-KASH fusion facilitates FACS sorting of cells and nuclei.DepositorInsertsU6_(SpaI)_sgRNA
Syn_EGFP-KASH
UseAAV, CRISPR, and Mouse TargetingExpressionMammalianPromoterSynapsin and U6Available sinceNov. 17, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pXPR_011
Plasmid#59702PurposeThis lentiviral vector can be used to assay Cas9 activity.DepositorInsertEGFP sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLH-stsgRNA3.1
Plasmid#64118PurposeVector for expression of St1 sgRNA3.1 in mammalian cellsDepositorInsertSt1 sgRNA3.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYLsgRNA-AtU6-29
Plasmid#66203Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYLsgRNA-AtU3b
Plasmid#66198Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterAtU3bAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6-Cj-sgRNA
Plasmid#89753PurposeU6 promoter driven expression of Cj-SgRNA cloned with BsmbIDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCj-SgRNA
UseSgrna expression under u6 promoterPromoterU6Available sinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT7EGFPgRNA
Plasmid#46760DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertegfp target
UseCRISPRPromoterT7Available sinceAug. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6c:sgRNA#4
Plasmid#64248Purposeexpresses sgRNA under U6c promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT7tyrgRNA
Plasmid#46761DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserttyr gRNA (tyr Zebrafish)
UseCRISPRAvailable sinceAug. 6, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRISPRia-v2
Plasmid#84832PurposeCRISPRi/a V2 library parental plasmidDepositorInsertssgRNA
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
shp53 pLKO.1 puro
Plasmid#19119Purpose3rd gen lentiviral vector for knocking down p53 gene expressionDepositorPublicationInsertsmall hairpin RNA against tumor protein p53 (TP53 Human)
UseLentiviral and RNAiExpressionMammalianAvailable sinceSept. 9, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYLsgRNA-AtU3d
Plasmid#66200Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterAtU3dAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Tet-pLKO-puro-Scrambled
Plasmid#47541PurposeTet inducible scrambled shRNA.DepositorInsertScrambled shRNA
UseLentiviral and RNAiExpressionMammalianPromoterH1Available sinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRISPomyces-2
Plasmid#61737PurposeStreptomyces expression of codon-optimized Cas9 and custom gRNADepositorPublicationInsertssSpCas9
gRNA cassette
UseCRISPRExpressionBacterialMutationBbsI-flanked lacZ cassette inserted in place of s…Promotergapdhp(EL) and rpsL(XC)-BbsIAvailable sinceJan. 27, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKS diaCas9_sgRNA
Plasmid#74923PurposeExpresses Cas9 codon optimized for Phaeodactylum tricornutum and a sgRNA driven by a U6 promoterDepositorInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPRPromoterCas9 module and sgRNA moduleAvailable sinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by