We narrowed to 14,123 results for: cas9 genes
-
Plasmid#91715PurposeCRISPR/Cas9-mediated genome editing in Arabidopsis. Contains Cas9 and empty gRNA scaffold, Kan resistanceDepositorTypeEmpty backboneExpressionPlantAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pLV.5’eGFP/sgLMNA
Plasmid#170546PurposeExpresses a sgRNA for 5' tagging to LMNA and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of LMNA
UseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
px330-mcherry
Plasmid#98750PurposeCas9 from S.pyogenes with CMV-mcherry cassette, and cloning backbone for sgRNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-Cetn1/1
Plasmid#50718PurposepX330 containing sgRNA against mouse Cent1. Positive control for DSB mediated EGFP reconstitution.DepositorInsertsCetn1 sgRNA1
humanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBh and hU6Available SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCasKP-apr
Plasmid#117231PurposeBacterial expression of Cas9 nuclease and lambda-Red system in Klebsiella PneumoniaeDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLdCN
Plasmid#84290PurposeExpress gRNA and Cas9 in Leishmania with Neomycin resistanceDepositorInsertgRNA and Cas9
UseCRISPR; LeishmaniaPromoterL. donovani ribosome RNA promoterAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
BPK2139
Plasmid#65776PurposeHuman expression vector for S aureus Cas9: CAG-humanSaCas9-NLS-3xFLAGDepositorInsertmammalian codon-optimized Staphylococcus aureus Cas9-NLS-3xFlag
UseCRISPRTagsNLS-3xFLAGExpressionMammalianPromoterCAGAvailable SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCasKP-hph
Plasmid#117232PurposeBacterial expression of Cas9 nuclease and lambda-Red system in Klebsiella PneumoniaeDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-CMV-mCherry-T2A-GFP
Plasmid#109427PurposeA lentiviral backbone expressing mCherry-T2A-eGFP off of a CMV promoter.DepositorInsertmCherry T2A GFP
UseLentiviralPromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBBK88 pHomL-TDH3p-Neon(gfp)-Link-2xPH(PLCd)-SSA1t-HomR (AmpR)
Plasmid#179072PurposeVector containing a yeast integration cassette for expressing TDH3p-Neon(gfp)-Link-2xPH(PLCd), an overexpressed (bright) marker for the plasma membraneDepositorInsertTDH3p-Neon(gfp)-Link-2xPH(PLCd)
ExpressionYeastAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
c3GIC9
Plasmid#62191Purposecol1a1 targeting vector for inducible [TRE3G]-GFP-IRES-Cas9 expression. Contains NsiI cloning site for U6-sgRNA cassettesDepositorInserthumanized S. Pyogenes Cas9
UseCRISPRTags3x FLAGPromoterTRE3GAvailable SinceAug. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP1594
Plasmid#65775PurposeHuman expression vector for S. thermophilus 1 Cas9: CAG-humanSt1Cas9-NLSDepositorInsertmammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS
UseCRISPRTagsNLSExpressionMammalianPromoterCAGAvailable SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAW-AlphaLobe
Plasmid#113255PurposeE. coli expression vector for His-MBP-Cas9 Alpha-Helical LobeDepositorInsertS. pyogenes Cas9 alpha-helical lobe
Tags10xHis-MBPExpressionBacterialMutationresidues 56–714; See paper for descriptionPromoterT7Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLdCH
Plasmid#84291PurposeExpress gRNA and Cas9 in Leishmania with Hygromycin resistanceDepositorInsertgRNA and Cas9
UseCRISPR; LeishmaniaPromoterL. donovani ribosome RNA promoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2T-gRNA2
Plasmid#196253PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA for guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBBK75 pHomL-RPL18Bp-Scarlet(rfp)-Link-2xPH(PLCd)-SSA1t-HomR (AmpR)
Plasmid#179059PurposeVector containing a yeast integration cassette for RPL18B-driven expression of Scarlet(rfp)-Link-2xPH(PLCd), a marker for the plasma membraneDepositorInsertRPL18Bp-Scarlet(rfp)-Link-2xPH(PLCd)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
SpG-IP
Plasmid#242073PurposeExpresses Cas9-SpG in mammalian cellsDepositorInsertSpG
UseCRISPRExpressionMammalianAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBBK54 pHomL-RPL18Bp-Neon(gfp)-Link-2xPH(PLCd)-SSA1t-HomR (AmpR)
Plasmid#179038PurposeVector containing a yeast integration cassette for RPL18B-driven expression of Neon(gfp)-Link-2xPH(PLCd), a marker for the plasma membraneDepositorInsertRPL18Bp-Neon(gfp)-Link-2xPH(PLCd)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti sgRNA CFP
Plasmid#155281PurposeLentiviral sgRNA cloning with CFP markerDepositorTypeEmpty backboneAvailable SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
EC64420
Plasmid#209517PurposeCloning in complete guide expression cassettes, with Cas9DepositorTypeEmpty backboneUseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC70364
Plasmid#209515PurposeCloning in complete guide expression cassettes, with Cas9DepositorTypeEmpty backboneUseCRISPRAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC67844
Plasmid#209514PurposeCloning in complete guide expression cassettes, with Cas9DepositorTypeEmpty backboneUseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMLS338
Plasmid#73719PurposeSapTrap Single plasmid targeting vector for tagging Unc-32 with GFP by CRISPR/Cas9DepositorInsertUnc-32::GFP(Cbr-unc-119)
UseCRISPR and Cre/LoxExpressionWormAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPN10-gDM1d
Plasmid#114387PurposepPN10 with gRNA for spCRISPR-Cas9 against the 3' UTR of the DMPK gene target: TGCGAACCAACGATAGGTG PAM: GGGDepositorInsertgDM1d
UseCRISPRAvailabilityAcademic Institutions and Nonprofits only -
pRB1081
Plasmid#71479PurposeExpresses gRNA for dpy-10 conversion using NGAG PAM and VQR Cas9 variantDepositorInsertdpy-10 gRNA
UseCRISPRExpressionWormPromoterU6Available SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRB1084
Plasmid#71516PurposeExpresses gRNA for dpy-10 conversion using NGCG PAM and VRER Cas9 mutantDepositorInsertdpy-10 gRNA
UseCRISPRExpressionWormPromoterU6Available SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
EC64434
Plasmid#209518PurposeCloning in complete guide expression cassettes, with Cas9 & Cas12a(D156R)DepositorTypeEmpty backboneUseCRISPRAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPN10-gCTG
Plasmid#114385PurposepPN10 with gRNA for spCRISPR-Cas9 targeted to CTG repeat, PAM: CTGDepositorInsertgCTG
UseCRISPRAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB4279
Plasmid#98698PurposeA control plasmid containing the intact bsdMX markerDepositorInsertCas9
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN10-gCAG
Plasmid#114384PurposepPN10 with gRNA for spCRISPR-Cas9 targeted to CAG repeat, PAM: CAGDepositorInsertgCAG
UseCRISPRAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-CRISPR
Plasmid#85402PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes with constitutive Cas9 expressionDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT2/CMV-eGFP.PB/PTK
Plasmid#170540PurposeExpresses the puromycin resistance gene fused to a thymidine kinase, upon excision of this cassette the reading frame of eGFP is restoredDepositorInsertDelta 5'-eGFP CMV-PuroTK- Delta 3'-eGFP
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV/eGFP-U6-sgRNA
Plasmid#170544PurposeA lentiviral backbone for homology directed insertion of eGFP. Containing only eGFP, flanked by restriction sites for insertion of homology arms and a sgRNA casstte to clone in sgRNA for HDRDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC50
Plasmid#104824PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.08g081600, Glyma.05g126600 (Hen1ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.08g081600, Glyma.05g126600
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA3
Plasmid#164929PurposeExpresses Non-targeting sgRNA3 control in mammalian cellsDepositorInsertNon-targeting sgRNA3 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA1
Plasmid#164932PurposeExpresses EGFP sgRNA1 in mammalian cellsDepositorInsertsgRNA1 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA2
Plasmid#164933PurposeExpresses EGFP sgRNA2 in mammalian cellsDepositorInsertsgRNA2 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC43
Plasmid#104817PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from Gmubi promoter from rolD promoterDepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC44
Plasmid#104818PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA4
Plasmid#164934PurposeExpresses EGFP sgRNA4 in mammalian cellsDepositorInsertsgRNA4 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA5
Plasmid#164930PurposeExpresses Non-targeting sgRNA5 control in mammalian cellsDepositorInsertNon-targeting sgRNA5 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC45
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC29
Plasmid#104803PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g094545 (Hen1). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g094545
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHDR-USR-eGFP
Plasmid#208830PurposeHDR Universal Surrogate Reporter with a sgRNA and consistently expressed eGFP but without Cas9. The selective PuroR reporter gene was designed to be repaired only by the sgRNA/Cas9-triggered HDR.DepositorTypeEmpty backboneExpressionMammalianPromoterCMV, U6Available SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only