We narrowed to 1,030 results for: CAT;
-
TypeBlog Post...found climbing mountains or playing with his two cats. Keira Havens grew up in Hawaii where she was fascinated...plants engineered to detect explosives and rapidly indicate their presence. They are genetically modified ...enjoy and see a future in. And we decided to make education and outreach a cornerstone of our business, because...
-
Technique: Probe Phage Genomes for Host Binding Proteins
TypeBlog Post...spending time with her horse, and wondering what her cat is thinking. Find her on Twitter @JessicaSacher. ... whole genome amplification (by a mechanism known as multiple displacement amplification) even in the ...same location that their host colonies grew. If your cells of interest stick to the same location as a...adding methyl groups, glycosyl groups, and other modifications to their bases in order to protect their DNA...DNA from host cell nucleases (4). To further complicate matters, even when sequenced, phage genomes tend...compressed nitrogen gas; this shears DNA at random locations and allows for a given fragment size to be selected... for physical shearing exist as well, such as sonication and needle shearing. Essentially, any method ... -
DNA Quantification
TypeProtocol... Protocols DNA Quantification DNA Quantification You may also like... Addgene’s DNA Quantification Protocol. Protocols... to protein (260/280) is generally used as an indicator of the purity of DNA samples. These days, many... -
CRISPR Library Amplification
TypeProtocol... Protocols CRISPR Library Amplification CRISPR Library Amplification You may also like... Pooled libraries...quantities of library for experimental applications. Repeated amplifications should be avoided as best as possible...Follow this protocol to perform amplification of CRISPR pooled plasmid libraries in Escherichia coli ...refer to our pooled library material pages for amplification protocols that have been developed by the depositor...available. If a pooled library does not yet have an amplification protocol, the following protocol can be used... CRISPR libraries. This protocol allows the amplification of a pooled-plasmid library in Escherichia coli...genes in an organism's genome, for example. Amplification is usually necessary to produce sufficient quantities... -
AAV Purification by Iodixanol Gradient Ultracentrifugation
TypeProtocol.... The arrow indicates the 60–40% interface. The vertical black line indicates the location of the purified... Protocols AAV Purification by Iodixanol Gradient Ultracentrifugation AAV Purification by Iodixanol Gradient...isomolar density gradient medium suitable for virus purification and isolation of cells, organelles, lipoproteins...and use an iodixanol column gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer..., et al. "Recombinant adeno-associated virus purification using novel methods improves infectious titer...opens in a new window) . Right panel: cartoon indicating the position of the needle for harvesting of ... -
Plasmid Modification by Annealed Oligo Cloning (with Protocols)
TypeProtocol... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo... final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3... -
Affinity Purification of Recombinant Antibodies with Protein A or Protein G
TypeProtocol...Affinity Purification with Protein A or Protein G Recombinant Antibody Affinity Purification with Protein... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TCTAATTGGTCTGTACCTaaagtggccgctaaggAAGCCCCCTGGGCTGATA lycat TAL3482 & TAL3483 TCCTTCATCTTCATCCAGcggcgctgggaggacgACCGCACACACATGAGCA lyl1 TAL3110...abcg2a TAL3400 & TAL3401 TGTCCTCATCCCCGTCCCgccgcggcgccaccgtCAGCTTCCACAACATCAA adam15 TAL3016 & TAL3017...TAL3017 TGTTTCTGGCGGACTCTCgtcaccattcttctgtTTGAAGGCACACCTTTGA ahcyl1 TAL3018 & TAL3019 TGACAGACTGTGGCGAGGatgccaagctggaggcGACGAAACAGGCCAGCAA...Aminopeptidase-o TAL3020 & TAL3021 TGATCTGGATCCTAACAAggatgacttgcccctgtGTGCGAACACCAACCATA arf6 TAL3212 & TAL3213 TGGGGAAGATGCTTTCCAagatcttcggcaacaaGGAGATGAGAATATTGA... arnt1 TAL3214 & TAL3215 TCCCGTCTCTGGCCATGAcctcctctaatggatcTCATTCCAACGGTGTGCA apoa4 TAL3022 & TAL3025 ...TAL3025 TGGCAGGACCAACCAATGcccagcatggacctggTGAAAAATGCTTTCTGGA apoa4-like TAL3023 & TAL3024 TGAAGGTTCTTGTGGTGCtcacacttgctgtggtTACAGGTAAGAAACTAAA...arap3a TAL3026 & TAL3027 TGGCAACAATCGGTCCGTgctcagatgcagaggaCCTGTTGGCTTCCATCCA ARSA TAL 3002 & TAL 3003... -
Validated gRNA Sequences
TypeCollection...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut S. pyogenes 25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC... sapiens GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut...sapiens TGACATCAATTATTATACAT cut S. pyogenes 26789497 Corn CXCR4 H. sapiens CCTCTTTGTCATCACGCTTC cut S.... sativa CATATAGTTGGGTCATGGCA cut S. pyogenes 26479191 Kim DWD1 O. sativa TGCATCGTCCAAGCGCACAG cut S. pyogenes...upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR... -
Fluorescent Protein Guide: Biosensors
TypeCollection...encoded sensor and small molecule indicator: implications for quantification of cytosolic Zn(2+). ACS Chem... few popular categories of biosensors or browse all the biosensors tagged in our catalog . Use the article...Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded Calcium Indicators. Janelia...calcium indicators for optical imaging (GECOs), including blue, green, red, and ratiometric indicators An ...calcium indicator for fluorescence using HaloTag ligands A modular chemigenetic calcium indicator enables...fluorescence indicator of K+ for optical imaging (GINKO) Genetically encoded fluorescent indicators for imaging...Multicolor palette of ATP indicators (MaLion) RGB-color intensiometric indicators visualize spatiotemporal... -
CRISPR Guide
TypeCollection... organisms, but modifications to various Cas enzymes have extended CRISPR applications to increasingly...following the amplification protocol specified by the depositing lab. After amplification, you’ll need ...heritability. Not all modifications are stable across cell divisions, and some types of modifications are more frequently... subsequently isolated by affinity purification. After purification, molecules associated with the locus...conventional methods for genomic purification, CRISPR-based purification methods are more straightforward...and SHERLOCKv2) allows for greater amplification and quantification and can be used on lateral flow strips...table above, 3' and 5' indicate on which end of targeted sequence the PAM is located. The majority of the... -
Antibody Guide
TypeCollection...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...production and storage techniques, and explain common applications. Science... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...Selectable Marker PI Publication Epigenetics To make targeted epigenetic modifications, researchers have ...DNA. Fusing the catalytic domain of ADAR2(E488Q) adenosine deaminase to catalytically dead Cas13b creates... Gene/Insert Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...Insert Promoter Selectable Marker PI Publication Visualize A catalytically inactive Cas9 (dCas9) fused to a...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...OPEN gAGCATCACCtcgctGGAGGTGAGc PTRF/Cavin1 OZ513 and OZ514 OPEN OPEN gACAGCCGTCtgcatctGGAGGTGCCc pitrm1...OPEN OPEN aGCCATCATCaggttcaGGATGAGCCc Kif6 OZ537 and OZ538 OPEN OPEN aAGCTTCCTCttcattgGCTGACTGCa ldr (low...CODA OPEN cAACCTCAGCATAAAGCTGGAGGAg psen2 OZ577 and OZ578 CODA OPEN cGGCATCTCCAGAGCCCGAGGCGGACc zgc:162148...hydroxylase (dbh) OZ525 and OZ526 OPEN OPEN tCCCATCCTAtcgttGCATGAGCTc mdka (midkine-related growth factor) OZ527...lipoprotein receptor) OZ539 and OZ540 OPEN OPEN tTGCATCCACggcagTCGGCAGTGc Encephalopsin (Opn3) OZ541 and OZ542 OPEN... OPEN OPEN aTCCATCCCAaacacatGTGGCAGAAt NFATc1 OZ543 and OZ544 OPEN OPEN aCCTCGCCTCagtgtGACGGAGGAc Swachmann-Bodian-Diamond...gCGCCACGGAcaataaaGAGGACTGCa GUSB OZ551 and OZ552 OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor 2 OZ553 and OZ554 OPEN... -
CRISPR History and Development for Genome Engineering
TypeCollection...development of new applications. The first CRISPR papers described two main categories of genome edits. ... lower off-target cleavage frequency. Truncated gRNAs: Truncated gRNAs display less off-target activity...therapeutic applications. Despite the ethical controversies surrounding non-research applications, it’s clear...just as useful (if not more so) for research applications, eclipsing past genome engineering technologies...number/types of Cas proteins. Makarova et al. ’s classification defines 5 types and 16 subtypes based on shared...for CRISPR genomic editing. Genome Engineering Applications In 2012, Jinek et al. first demonstrated that... PubMed lists more than 6,300 CRISPR-related publications, many of which detail work to improve the tool... -
CRISPR Plasmids - Bacteria
TypeCollection...ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional... Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...population. ID Plasmid Promoter PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function Genome Editing...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...gRNA Design Tools CRISPR Blog Posts Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...plasmids containing only the elements needed for replication in the host cell and are designed for a user ...Protein Function: Viral Vector Delivery, Genome Modification, mRNA Regulation, and More Selectable Markers...collection page Zebrafish CMV, h2afv, XlEef1a1 See our dedicated Zebrafish Plasmids and Resources collection page...Additionally, tags are commonly added to aid in protein purification. Just remember to remove the stop codon for ...myristoylation signal GST Protein purification pEBG - N-terminal GST for mammalian...expression GST plasmids made by Addgene MBP Protein purification pET28-MBP-TEV - Bacterial expression with MBP-TEV...MBP-tagged fusion proteins in E. coli SUMO Protein purification pCIOX - Bacterial expression vector for His8... -
Immunology Research Plasmids and Resources
TypeCollection... CAMP cathelicidin antimicrobial peptide CAP18, CRAMP, FALL-39, FALL39, HSD26, LL37 CAT catalase MGC138422...hCD40L CD70 CD70 molecule CD27L, CD27LG, TNFSF7 CECR1 cat eye syndrome chromosome region, candidate 1 ADGF,...CREB, MGC9284 CTSB cathepsin B APPS, CPSB CTSE cathepsin E CATE CTSL1 cathepsin L1 CATL, CTSL, FLJ31037,...phosphoinositide-3-kinase, catalytic, delta polypeptide p110D PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide...and adaptive immune signaling and cell-cell communication. Plasmid... -
CRISPR Plasmids - Purify Genomic Loci
TypeCollection...Catalytically inactive CRISPR plasmids for purification of target loci....conventional methods for genomic purification, CRISPR-based purification methods are more straightforward and...Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Yeast ID...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...chromatin immunoprecipitation (ChIP) to allow purification of any genomic sequence specified by a particular...DNA-binding molecule-mediated ChIP) system, catalytically inactive dCas9 is used to purify genomic DNA... can be fused to dCas9 or gRNA for efficient purification. Various epitope tags including 3xFLAG-tag, ... -
CRISPR Plasmids - Yeast
TypeCollection...Insert Promoter Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted... -
Plan Your Experiment
TypeCollection...Achieving your desired edit comes down to location, location, location. Positioning your chosen Cas enzyme ...designing the gRNA component for each category. Genetic Manipulation Application Cas Enzyme Additional Considerations...the table below, we highlight the most common categories of genetic manipulations used in mammalian cells...gene you target will depend on your specific application. Knockout : Target constitutively expressed regions...start sites that could allow for expression of a truncated protein. Targeting an exon coding for an essential... Select a cut site as close as possible to the location of the desired edit, ideally less than 10 bp away...complex. You then delivery the RNP to cells using cationic lipids, electroporation, or an endosomal approach... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...target sites, and catalyzes recombination between them. Most SSR enzymes are categorized into two distinct...a genomic attP site. So far, their practical application has been limited by low integration efficiency...after recombination (inversion, deletion, or translocation) depends on the orientation of each target site...are on separate DNA molecules (in trans), a translocation event is generated between the target sites....(Length) Common Variants Cre loxP ATAACTTCGTATAgcatacatTATACGAAGTTAT 13 bp inverted repeats + 8 bp spacer...By expressing the enzyme at specific times or locations using cell-specific promoters or inducible systems... used for more than inversion, deletion, or translocation of a gene of interest. Using Cre or Flp as examples... -
CRISPR Plasmids - Double-Strand Break (Cut)
TypeCollection...Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid...Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication C. elegans...Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Zebrafish...Marker PI Publication Xenopus ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Parasites...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that... -
Bacterial Expression Systems
TypeCollection...for protein purification. The pTD Plasmid Series contains plasmids suitable for replication in many gram-negative...expression plasmids that can be used for protein purification, protein visualization, study of protein interactions...Systems Bacterial Expression Systems Protein Purification Protein Visualization Protein Interactions Controlled...Bacteria are commonly used to create, store, and replicate plasmids of all types, but beyond that, researchers...expression plasmids to find out more! Protein Purification To study the function, structure, and activity...through affinity chromatography. To facilitate the purification process, proteins are often expressed alongside...Browse our most popular plasmids for protein purification. Commonly used tags, cleavage sites, and signal... -
CRISPR Plasmids - Plants
TypeCollection...Gene/Insert Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9 H840A nickase fused to a reverse... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection... any application Balanced Salt Solution (BSS) An ophthalmic solution suitable for any application TMN200...ordering information. ID Name Promoter Description Category PI 157970 pTR-UF11 chimeric CMV/Chicken Beta actin...When using the AAV2(Y444F) serotype in future publications, please acknowledge Arun Srivastava and cite...When using the AAV2(trpYF) serotype in future publications, please acknowledge Arun Srivastava and cite... using the AAV2(4pMut)dHS serotype in future publications, please acknowledge Shannon Boye and cite Boye...using the AAV6(dbY-F+T-V) serotype in future publications, please acknowledge Arun Srivastava and cite...Strategies for Overcoming Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495.... -
CRISPR Plasmids - Epigenetics
TypeCollection...make targeted epigenetic modifications, researchers have fused catalytically dead dCas9 to epigenetic ...Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...CRISPR plasmids for targeted epigenetic modification, including histone acetylation/demethylation, and...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...enhancer for your gene of interest. Available modifications include: histone acetylation by p300 histone...or MQ1 cytosine demethylation by Tet1 These modifications persist over time and are potentially heritable...tables below for CRISPR plasmids for epigenetic modification in mammalian or plant systems. Mammalian ID ... -
Caltech Systemic Capsids
TypeCollection...Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato...Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-...Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP CAG EYFP, Cre-dependent...Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden MaCPNS2...Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B10...Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B22...Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden AAV9... -
Serotype Testing AAV
TypeCollection...the material page (linked for each catalog ID below). Serotype Catalog ID Volume Price* AAV1 37825-AAV1....the material page (linked for each catalog ID below). Serotype Catalog ID Volume Price* AAV1 50465-AAV1....sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized testing sample is denoted...denoted with a .T suffix (for example, AAV1.T). The catalog ID for the 100 µL sized sample does not have the...from the CAG promoter. For information about each catalog item, including the titer and quality control, ... synpasin promoter. For information about each catalog item, including the titer and quality control, ...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...advantage of using AAV for research is that it is replication-limited and typically not known to cause disease...certain exogenous gene products that mediate AAV replication. This requirement has been circumvented with ...expressing Rep2 and PHP.eB Cap controlled by tTA-TRE amplification system Viviana Gradinaru 103006 pUCmini-iCAP-PHP.S...expressing Rep2 and PHP.S Cap controlled by tTA-TRE amplification system Viviana Gradinaru 127847 pUCmini-iCAP-PHP.V1...expressing Rep2 and PHP.V1 Cap controlled by tTA-TRE amplification system Viviana Gradinaru 175004 pUCmini-iCAP-AAV.CAP-B10...expressing Rep2 and B10 Cap controlled by tTA-TRE amplification system Viviana Gradinaru 175005 pUCmini-iCAP-AAV.CAP-B22...expressing Rep2 and B22 Cap controlled by tTA-TRE amplification system Viviana Gradinaru 185136 pUCmini-iCAP-AAV.MaCPNS1... -
CRISPR Plasmids - Activate Gene Expression
TypeCollection...Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid...Promoter PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication C. elegans...Promoter PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Protocols gRNA Design Tools CRISPR Blog Posts Catalytically dead dCas9 fused to a transcriptional activator... -
All Antibodies
TypeCollection...antibodies. These monoclonal antibodies undergo application-specific validation and quality control by Addgene...all the antibodies currently available from our catalog. Addgene values transparency and accessibility ...antigen. Addgene supplies a list of recommended applications based on our in-house testing and data provided...with full experimental details in the Antibody Applications section of our product pages. We also include... an antibody’s use is not recommended for an application or species. We currently assess western blot,...scientists to further develop and refine these application lists. The plasmids we use to produce antibodies...intractable via animal immunization. Addgene's antibody catalog is a community resource that is growing! We welcome... -
CRISPR Plasmids - Base Edit
TypeCollection...Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Plant ID...Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Zebrafish...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...editors are created by fusing Cas9 nickase or catalytically inactive “dead” Cas9 (dCas9) to a cytidine deaminase...and are thus well suited to directed evolution applications. Examples of these base editing systems include...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that... -
CRISPR Plasmids - Drosophila
TypeCollection...ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...but their function is often limited to a single category (cut, nick, etc.) On the other hand, gRNA plasmids... -
Brain Initiative Collection
TypeCollection... the human brain through the development and application of innovative tools enabling large-scale real-time...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ...Gradinaru 105448-AAV9 pAAV-hSyn-DIO-ChrimsonR-mRuby2-ST Cation channelrhodopsin ChrimsonR fused to mRuby2 fluorophore...108912-AAV9 pAAV-CAG-DIO-ChroME-ST-P2A-H2B-mRuby3 Cation channelrhodopsin ChroME targeted to the neuronal.... Useful for nuclear isolation and scRNA-seq applications. Jonathan Ting 163909-AAV9 pAAV_hSynapsin_psychLight2...and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector expressed...2P-WPRE Double floxed genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector under ... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection... the original publication below. You can also download the full-text of the publication here . Article...given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function... of Visualized Experiments (JoVE). The video publication by Stuart Orkin's and Daniel Bauer's labs details...addition, we describe techniques for deletion, identification, and characterization. This strategy relies...elements. For creating a gene knockout, two sgRNA located within exons will enrich even monoallelic deletion...Alternatively use another transfection method such as cationic liposome-based transfection. Optimize transfection...10.3791/52118 (2015). PubMed For the complete publication, including representative results and discussion... -
Ras Pathway
TypeCollection...: A1,A2: Catalytic subunit alpha B1,B2: non-catalytic subunit beta G1, G2, G3: non-catalytic subunit gamma... below. Color is used for clarity and does not indicate a specific relationship. The content and map for...Research Color is used for clarity and does not indicate a specific relationship. The content and map for...Phosphatidylethanolamine binding protein 1 PIK3 Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory...Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic and regulatory subunits - Class I PIN1 Peptidylprolyl...PLXNB1 Plexin B1 PPP1CA Protein phosphatase 1 catalytic subunit alpha PREX2 Phosphatidylinositol-3,4,5... -
Distribution to Industry
TypeCollection...activity in a variety of cell types. Protein Purification Optimization Kit Using SUMO Protease Elution...antibodies are produced in-house and undergo application-specific validation and quality control by Addgene... Recombinant Antibody Reactivity Recommended Applications PI Don't See What You're Looking For? Please...within 1 business day regarding your account verification. Once your account has been verified, you will.... Pricing Addgene is a nonprofit organization dedicated to providing the scientific community with open...access to plasmid research tools. Pricing will be indicated on the product pages after you login to your account... the depositing institutions. These agreements indicate the language which we are allowed to use for distribution... -
Plasmids for Stem Cell Research
TypeCollection...Blood Cells. Stem Cells. 2012 Nov 29. Yamanaka Replicating EBNA1 episome Human Non-integrating EBNA1-mediated... Nat Methods. 2011 May;8(5):409-12. Yamanaka Replicating EBNA1 episome Human Non-integrating polycistronic... S A. 2014 Jul 22;111(29):10678-83. Capecchi Replicating EBNA1 episome Human Fluorescent-tagged EBNA1-...Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating EBNA1-mediated...RNA Human Non-integrating, polycistronic, self-replicating VEE RNA species expressing human Oct4, Klf4, ...generation of human iPSCs by a synthetic self-replicative RNA. Cell Stem Cell. 2013 Aug 1;13(2):246-54....Science. 2008 Nov 7;322(5903):949-53. Yamanaka Replicating EBNA1 episome Mouse Non-integrating EBNA1-mediated... -
Neurodegeneration Research Collection
TypeCollection...loci seem to be associated with the disease and implicate a wide range of cellular processes. The vast majority... consists mainly of managing symptoms through medication and surgery. PD primarily involves the malfunction...available from Addgene, sortable by type of genetic modification and target species. You can also find our guide...Sun et al. Nat Methods. 2020 Oct 21. Glutamate indicators with improved activation kinetics and localization...A multicolor atlas for whole-brain neuronal identification in C. elegans. Yemini et al. Cell. 2021 Jan...window) A news website and information resource dedicated to helping researchers accelerate discovery and...Foundation (Link opens in a new window) A foundation dedicated to finding a cure for Parkinson's disease through... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...the most abundant forms of posttranslational modification in cells and research into its many roles in...Importantly, phosphorylation positional isomers are allocated to different subpools, allowing precise knowledge...BL21ΔserB Plasmid 34624 SepOTSα tRNA-Sep ( aka. pCAT112TAG-SepT) Plasmid 34623 SepOTSα SepRS/EF-Sep ( aka...phosphopeptides in bacteria for proteome-wide identification of phosphorylation-dependent interactions ....programmable protein phosphorylation . Nature Communications , 6 (1). https://doi.org/10.1038/ncomms9130... using cell-free protein synthesis . Nature Communications , 6 (1). https://doi.org/10.1038/ncomms9168...in a new window) Additional Resources See our dedicated Genetic Code Expansion collection page Read about... -
CRISPR Plasmids - Repress Gene Expression
TypeCollection...Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid ...Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Protocols gRNA Design Tools CRISPR Blog Posts Catalytically dead dCas9, or dCas9 fused to a transcriptional... -
CRISPR Plasmids - Single-Strand Break (Nick)
TypeCollection...Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Drosophila...Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Yeast ID ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Description Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that... -
CRISPR Plasmids - CRISPR Transposases (CAST)
TypeCollection...Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Selectable Marker PI Publication Last reviewed...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...integration of large fragments of DNA at specific locations. The Cas effector lacks nuclease activity, instead... (comprised of multiple components) to target locations in the genome defined by a guide RNA. The transposase...insertions — meaning they may not be suitable for applications where orientation of the insert is important... -
CRISPR References and Information
TypeCollection...Labs. ACEofBASEs (Link opens in a new window) Identification of sgRNA target sites and off-target evaluation...number of potential off-targets, target's genomic location, and genome annotation. Available genomes are ...sequence, which can be an accession number, genomic location, pasted nucleotide sequence, or a sequence text... Target Finder (Link opens in a new window) Identification of gRNA target sequences from an input sequence...window) A collection of protocols, materials, and publications by members of the Division of Signaling and ...Download protocol Addgene CRISPR pooled library amplification CRISPR pooled libraries Protocol at Addgene ...CMV-EGFP PDF, 2.4 MB Zhang GeCKO pooled library amplification 1 vector system: lentiCRISPR v2 2 vector system... -
CRISPR Plasmids - C. elegans
TypeCollection...ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...but their function is often limited to a single category (cut, nick, etc.) On the other hand, gRNA plasmids... -
Malate Dehydrogenase CUREs Community Collection
TypeCollection...dehydrogenase (MDH). The MCC is a national group of educational leaders providing research opportunities to their...other members of the MCC community. They support educators interested in integrating MDH-related research...professional development, membership to a local hub of educators teaching MDH CUREs, and opportunities to mentor...of action, regulation and post-translational modifications, and metabolic pathways and protein interactions...His-tags are cloned at the C-terminus of MDH and, if indicated on the plasmid map, a TEV cleavage site is present...access for biochemistry research in undergraduate education: The malate dehydrogenase CURE community. J Biol... -
Antibody Production
TypeCollection...recommended applications. The specific QC experiments performed varies for each antibody catalog item. Whenever...specific antibody can be found on the antibody's catalog page or by contacting [email protected] . Some of...Innovation (IPI). For these antibodies, IPI will be indicated as the Depositing Lab on the antibody webpage....cells and will interfere with conjugation. For applications such as these, the buffer can be removed by ...aliquots before storing at -20 °C. Each antibody catalog item is tested for shipping stability by incubating... -
Antibody Plasmid Collection
TypeCollection...antibodies are produced in-house and undergo application-specific validation and quality control by Addgene...extensively validated for neuroscience research applications from the NeuroMab/Trimmer Lab Recombinant mAb...imaging. Learn more about antibodies and their applications in our Antibody Guide ! Cloning and Expressing...antibodies, and Fc-silent mutants. Functional diversification of hybridoma-produced antibodies by CRISPR/...456(1):527-33. Gavin Wright pET-30-based vector dedicated to efficient scFv expression, which circumvents...and Generation of synthetic nanobodies against delicate proteins. Nat Protoc. 2020 Apr 8. Markus Seeger... -
mTOR Pathway
TypeCollection...cell and regulates the switch from anabolic to catabolic processes. Active mTORC1 promotes protein and ...energy-intensive processes. mTORC1 also blocks catabolic processes including autophagy and lysosome biogenesis... below. Color is used for clarity and does not indicate a specific relationship. The content for this ...Pathway Color is used for clarity and does not indicate a specific relationship. The content for this ...Pyruvate dehydrogenase kinase, isozyme 1 PI3K Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory...Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic and regulatory subunits - Class I PKC PKC alpha...