...organizations, libraries, youth groups, and faith institutions. The conversations often move quickly into sensitive...

...The day has arrived; you’ve painstakingly cared for your packaging cell line, prepped your DNA, transfected...

... decide what they’d like to work on later. For instance, AstraZeneca posts most of its positions all at...

...excellent posts on science career topics as well. Instead of rewriting or coming up with answers, I was able...

...genome-wide CRISPR screen presented in Morgens et al. contains three types of guides: 1) targeting guides (blue...

...Highlight your achievements with specific examples. Instead of saying “I have excellent communication skills...

...ml). NOTE: Phosphorylated oligos may be ordered instead. For this approach, the use of T4 PNK is omitted...type. While MEL cells are suspension cells, instructions for adherent cells have also been included. ... clones to a single 96-well plate that already contains 50 μl cell culture media per well for a final ...protein, perform an immunoblot using an antibody against the relevant protein 9 . References This protocol...

...recombinant antibodies targeting neuroscience-related proteins....currently available from our catalog that target proteins popular in neuroscience research. These ready-... represent the official views of the National Institutes of Health....

...Mammalian ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter PI Publication...Publication Yeast ID Plasmid Gene/Insert Promoter PI Publication Do you have suggestions for other plasmids...

... Plasmid Collections Fluorescent Proteins Michael Davidson Fluorescent Protein Collection...collection of ORFs tagged with a variety of fluorescent proteins. The majority of the ORFs are of mammalian origin...different fluorescent tags for you to create fusion proteins with your gene of interest. Please visit Michael...

...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacterial ID Plasmid Gene/Insert PI Publication...Publication Plant ID Plasmid Gene/Insert PI Publication Do you have suggestions for other plasmids that should...

...joining (NHEJ); a mechanism which frequently causes insertions or deletions (InDels) in the DNA, possibly resulting... with the Cas9 and gRNA plasmids, the cell may instead repair the break using homology-directed repair...introduce specific genomic changes. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors...

...joining (NHEJ), a mechanism which frequently causes insertions or deletions (indels) in the DNA. Indels often...repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental systems, HDR occurs...much lower efficiency than NHEJ. ID Plasmid Gene/Insert Vector Type Promoter PI Publication Empty gRNA ...

... determine the three dimensional structures of proteins of medical relevance, and place them in the public...pFHMSP-LIC-N N/A Expression vector for secreted proteins with N-terminal hexahistidine tag and TEV cleavage...pFHMSP-LIC-C N/A Expression vector for secreted proteins with C-terminal hexahistidine tag and TEV cleavage...

...recommended that you determine if your cell type contains the target sequence before using any of these ...single species or PAM binding variant of Cas9. For instance, wild-type SpCas9 must be used with targets that...experimental use of these plasmids. ID Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions...

...two options: Film outside at a distance, or film inside with one person in a room. I wouldn’t be in there...

...generates large genomic deletions. Insert NEW CRISPR transposases insert large fragments of DNA. Transcriptional...nickase enzymes fused to reverse transcriptase install new genetic information into a specific DNA site...

...candidate Scotin Shisa family member 5 Sestrins SESN1 SESN2 SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin...DNA-damage-inducible; alpha, beta, or gamma IGF-BP3 Insulin-like growth factor binding protein 3 KAI CD82 molecule...

...GTGGTGGGCCGCAGTCACAA 66894 cut S. pyogenes 26178787 Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586...GCGAGGTATTCGGCTCCGCG 66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT...TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes 26178787 Winslow NeuN M. musculus TCCGGTTCAGGGACCCCGAC 60227 cut... cut S. pyogenes 26480473 Wolfe ttTi5605 Mos1 insertion site C. elegans ATATCAGTCTGTTTCGTAA 47550 cut ...

...and sarcasm, persistent teasing, name calling, insults, intimidation, sexual harassment Isolation – including...

...that expresses tTA from the hSyn1 promoter that contains a positive feedback loop for amplifed expression...expression of the tTA from the hSyn1 promoter. Contains a positive feedback loop for amplifed expression...-AAV9 pAAV-hsyn-GRAB_DA-mut Expresses the DA-insensitive control sensor GRAB_DA-mut in neurons Yulong ...pAAV-hsyn-GRAB_rDA-mut Expresses the red fluorescent DA-insensitive control sensor GRAB_rDA-mut in neurons Yulong...

...analysis plan when you design your experiment, instead of after you’ve already run it.) You don’t need...

...CRISPR Genome Editing : John Doench from the Broad Institute gives practical advice for designing your gRNA... by the Doudna Lab at the Innovative Genomics Institute, University of California, Berkeley. CRISPR Software...Mendenhall & Myers Mammalian: FLAG tagging endogenous proteins pFETCh_Donor ; additional HDR & gRNA plasmids ...

...antibodies targeting epitope tags and common fusion proteins.... target epitope tags and other common cellular proteins. These ready-to-use recombinant monoclonal antibodies...

...Networks & Gene Regulation Sensing & Signaling Strains Browse Addgene's collection of synthetic biology...available from this depositor's lab. Plasmid Gene/Insert Vector Type Promoter Tags PI Publication Do you...

...table based on plasmid name, gene/insert, and more. ID Plasmid Gene/Insert Vector Type Backbone Mutations...

...Networks & Gene Regulation Sensing & Signaling Strains Browse Addgene's collection of synthetic biology...available from this depositor's lab. Plasmid Gene/Insert Vector Type Promoter PI Publication Back to Top...

...Networks & Gene Regulation Sensing & Signaling Strains Browse Addgene's collection of synthetic biology...available from this depositor's lab. Plasmid Gene/Insert Vector Type Promoter PI Publication Back to Top...

...reagents for engineering and expressing zinc finger proteins deposited by Zinc Finger Consortium members like...reagents for engineering and expressing zinc finger proteins for distribution to academic and nonprofit laboratories...

...phenotype. The National Human Genome Research Institute (NHGRI) is funding this collaborative program ... funded by the National Human Genome Research Institute (NHGRI) (Link opens in a new window) . Find IGVF...

...Networks & Gene Regulation Sensing & Signaling Strains Browse Addgene's collection of synthetic biology... this depositor's lab. Plasmid Description Gene/Insert Vector Type PI Publication Back to Top Shuttle ...

...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable...

...Empty gRNA expression vectors for insertion of custom gRNA target sequences...., Xenopus, Worm, or Other. Whether the plasmid contains Cas9 and if so, which function of Cas9. We have... as Puromycin or EGFP Cloning enzyme used for insertion of your gRNA sequence, such as BsbI or BsaI Cas9...

...comprehensive human transcription factor collection that contains 1,836 genes encoded by 3,548 isoforms and two ...scRNA-seq (PDF, 59.2 KB) Plasmids ID Plasmid Gene/Insert Pooled Library The MORF pooled library is a comprehensive...

...sites. Vectors encoding wild-type FokI nuclease domains: pST1374 (for expression in mammalian cells or ...) Vectors encoding heterodimeric FokI nuclease domains: pMLM290 (for expression of a “+” heterodimeric...

...CRISPR Blog Posts The David Bikard Lab at the Institute Pasteur has deposited a collection of CRISPR arrays...protein dCas9 is expressed along a CRISPR array that contains 20 bp "addresses", where dCas9 is going to bind...

...prep and how to make your own preps. Recipient Instructions What to do when you receive your viral vector...storage. Biosafety Guide Documentation for your institutional biosafety office and your lab, information on...

... Keith Joung This kit consists of plasmids and strains used to engineer ZFNs via the Oligomerized Pool... packaged plasmids and 3 individually packaged strains, which are shipped as bacterial stabs at room temperature...

...two complexes, mTORC1 and mTORC2. Each complex contains a unique subunit: raptor for mTORC1, and ...but it is activated by growth factors, including insulin. mTORC2 influences cell survival and cytoskeletal...

...factors), and downstream (by GAPs, GTPase activating proteins, which also serve effector roles). A compatible..., & Ettema, T. J. (2016). Tracing the archaeal origins of Eukaryotic Membrane-Trafficking System building...

... control AAV collection, including fluorescent proteins, spaghetti monster, and more....Browse our control AAV that express fluorescent proteins under general promoters. These AAV can be used...

...s lab. It is derived from the AAV2 capsid and contains the following mutations: Y444F, Y500F, and Y730F...s lab. It is derived from the AAV6 capsid and contains the following mutations: Y705F, Y731F and T492V...

...TCTTCTTGTGCTCTTATTggcaggtacctggtgacTCACCTTATGGGCGCTGA matrixmetallopeptidase15 (membrane-inserted) TAL3484 & TAL3485 TGATCTGTTCCTGGTAGCcgttcatgagctgggcCATGCCCTTGGACTGGAA...TGATCTGTTCCTGGTAGCcgttcatgagctgggcCATGCCCTTGGACTGGAA matrixmetalloproteinase14a (membrane-inserted) TAL3486 & TAL3487 TGTTCCTGGTGGCGGTGCatgaattgggtcatgcaCTTGGTTTGGAGCACTCA...

...optogenetics AAV collection, including channelrhodopsins, halorhodopsins, and more....

...Huang, et al., 2019) for LY6A-permissive mouse strains). AAV-PHP.eC, AAV9-X1.1 and AAV1-X1 do not display...tropism and can be used in LY6A-nonpermissive mouse strains. **AAV1-X1 has not been tested in rats. Abbreviations...

...elements is followed by their insertion into the p1316 plasmid that contains an upstream CMV promoter for... coexpression of light (green) and heavy (blue) chains as driven by two CMV promoters (orange). Hybridoma-derived...chain across the ER membrane. Downstream of the insert is a heavy chain constant domain (C H ) that is...

...Consortium Plasmids All SGC Plasmids Plasmid Gene/Insert Vector Type Backbone Mutations Tags Industry PI...

...Genomics Consortium Plasmids - Oxford Plasmid Gene/Insert Vector Type Backbone Mutations Tags PI...

...Genomics Consortium Plasmids - Stockholm Plasmid Gene/Insert Vector Type Mutations Tags Industry PI...

...Genomics Consortium Plasmids - Toronto Plasmid Gene/Insert Vector Type Backbone Mutations Tags Industry PI...