165,839 results
-
Plasmid#8688DepositorInsert4 repeated M67 sites
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable SinceJuly 18, 2006AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.3b (AAV9)
Viral Prep#125560-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-dLight1.3b (#125560). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.3b plasmid DNA. CAG-driven expression of dLight1.3b dopamine sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsNoneAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-IGF1R-V5/HIS
Plasmid#201979Purposeexpression of human IGF1R receptor tyrosine kinase in mammalian cellsDepositorInsertIGF1R receptor tyrosine kinase (IGF1R Human)
UseTagsV5, 6xHisExpressionMammalianMutationPromoterCMVAvailable SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP (AAV8 trial size)
Viral Prep#37825-AAV8.TPurposeReady-to-use AAV8 trial size particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. CAG-driven GFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-LKB1
Plasmid#8590DepositorAvailable SinceJuly 18, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-GCaMP6s (AAV8)
Viral Prep#105714-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-fDIO-GCaMP6s (#105714). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO-GCaMP6s plasmid DNA. EF1a-driven, Flp recombinase-dependent expression of GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animalsDepositorPromoterEf1a, Human elongation factor-1 alphaTagsNoneAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-MCS
Plasmid#145245PurposeBackbone vector expressing GAL4 DNA-binding domain followed by MCSDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-rab11 WT
Plasmid#12674DepositorInsertRAB11A (Homo sapiens) (RAB11A Human)
UseTagsGFP and HAExpressionMammalianMutationPromoterAvailable SinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pET28-MHL
Plasmid#26096PurposeSGC Empty backbone for bacterial expressionDepositorTypeEmpty backboneUseTags6xHis and TEV cleavage siteExpressionBacterialMutationPromoterT7-lacO (lactose/IPTG inducible)Available SinceAug. 20, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV.CMV.Luc.IRES.EGFP.SV40
Plasmid#105533PurposeAAV expression of Luciferase and EGFP from CMV promoterDepositorInsertLuciferase
UseAAV and LuciferaseTagsIRES-GFPExpressionMammalianMutationPromoterCMVAvailable SinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiFUCCI(CA)5
Plasmid#223176PurposeLentiviral fluorescent ubiquitination-based cell cycle indicator (FUCCI)DepositorInsertFUCCI(CA)5
UseLentiviralTagsAzaleaB5-hCdt1(1/100)Cy(-)_P2A_h2-3-hGem(1/110)ExpressionMammalianMutationPromoterAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag hHMGB1
Plasmid#31609DepositorAvailable SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBZS-M.CviPII (NDel15)
Plasmid#198356PurposeExpress M.CviPII (NDel15) in bacterial cells.DepositorInsertM.CviPII
UseTagsExpressionBacterialMutationPromoterAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iAChSnFR (AAV9)
Viral Prep#137955-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CAG.iAChSnFR (#137955). In addition to the viral particles, you will also receive purified pAAV.CAG.iAChSnFR plasmid DNA. CAG-driven iAChSnFR acetylcholine sensor. These AAV preparations are suitable purity for injection into animals.DepositorArticlePromoterCAGTagsNoneAvailable SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
mEmerald-Sec23A
Plasmid#166893Purposemammalian expression of Sec23A tagged with mEmeraldDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-TargetBC-5xTAPE-1-pegRNA-InsertBC
Plasmid#183790PurposeA single construct out of the pool of plasmid for lineage recording experiment using DNA Ticker Tape.DepositorInsertsP2A-eGFP-TargetBC-5xTAPE-1
pegRNA-InsertBC
UseSynthetic BiologyTagsExpressionMutationG>A in the gRNA scaffold- please see depositor…PromoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459V2.0_Conc2
Plasmid#134451PurposeEmpty concatemer vector in which 2 sgRNAs can be inserted; with Cas9 + PuroDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HA-eLACCO2.1-NGR
Plasmid#208023PurposeBiosensor for extracellular L-lactateDepositorInserteLACCO2.1
UseTagsExpressionMammalianMutationPromoterAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn Con/Fon hChR2(H134R)-EYFP (AAV9)
Viral Prep#55645-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn Con/Fon hChR2(H134R)-EYFP (#55645). In addition to the viral particles, you will also receive purified pAAV-hSyn Con/Fon hChR2(H134R)-EYFP plasmid DNA. Synapsin-driven, Cre-dependent and Flp-dependent channelrhodopsin-EYFP expression for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEYFP (Cre- and Flp-dependent)Available SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mAMPKa1
Plasmid#79004PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 1.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM3D(Gq)-mCherry (AAV Retrograde)
Viral Prep#50474-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-hM3D(Gq)-mCherry (#50474). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM3D(Gq)-mCherry plasmid DNA. hSyn-driven hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCWXPGR-pTF-betaCatenin
Plasmid#114281PurposeTET-inducible expression of a constitutively active form of the BetaCatenin proteinDepositorInsertCatenin beta 1 (CTNNB1 Human)
UseLentiviralTagsFLAGExpressionMutationdeletion of AA 1 to 45PromoterAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBT281
Plasmid#122611Purposeexpress evoAPOBEC1-BE4max in mammalian cellsDepositorInsertevoAPOBEC1-BE4max
UseTagsExpressionMammalianMutationE4K H109N H122L D124N R154H A165S P201S F205SPromoterAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pet30b-7M SrtA
Plasmid#51141Purposeexpression plasmid for C-terminal his tagged, calcium independent S.aureus SrtA with enhanced catalytic activityDepositorInsertS.aureus SrtA 7M
UseTags6x HisExpressionBacterialMutationP94R, E105K, E108Q, D160N, D165A, K190E, K196TPromoterT7Available SinceFeb. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2pA2-9xGRE
Plasmid#74736PurposeGRE-dependent EGFP reporter construct flanked by the minimal Tol2 transposon elementsDepositorInsertEGFP
UseZebrafish expressionTagsExpressionMutationPromoternine GC-responsive elements (9xGRE) from the rat …Available SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mAMPKa2
Plasmid#79005PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 2.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-EYFP (AAV8)
Viral Prep#137162-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Con/Foff 2.0-EYFP (#137162). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Con/Foff 2.0-EYFP plasmid DNA. EF1a-driven expression of EYFP in the presence of Cre (inhibited in the presence of Flp). These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only