167,825 results
-
Plasmid#165959PurposeExpression of soluble E. coli Tus proteinDepositorInsertTus
TagsHis-NusA-TevExpressionBacterialPromoterT7Available SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-N-Ezrin
Plasmid#202684Purposefluorescent protein tagged ezrinDepositorInsertMus musculus EZR(1-586):EGFP (Ezr Mouse)
ExpressionMammalianAvailable SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-MCP-3XBFPnls
Plasmid#75384PurposeMCP-3XBFPnlsDepositorInsertMCP
UseLentiviralTags3XBFPExpressionMammalianPromoterEFSAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGTM_COV2_NSP5_004_SUMO
Plasmid#190062PurposeExpresses SARS-CoV-2 3CLpro for the expression of the active mature proteaseDepositorAvailable SinceJune 3, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
GST-AR-624-919
Plasmid#104200PurposeExpresses human AR-624-929 ligand binding domain in pGEX-5X-1 as GST fusion proteinDepositorAvailable SinceDec. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR_Gal4UAS_humanIL-2_IRES_mCherry_PGK_tBFP
Plasmid#85426PurposeLentiviral vector for Gal4 inducible humanIL-2 with mCherry reporter and constitutive tBFP expressionDepositorInserthuman IL-2
UseLentiviralAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
ADORA2A-Tango
Plasmid#66210PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lyso-GA
Plasmid#209874PurposeDimerization dependent fluorescent protein GA anchored to cytosolic face of the lysosomal membrane with human LAMP1DepositorInsertddGFP A
TagsLAMP1ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET24b-APEX2
Plasmid#111702PurposeFor IPTG-inducible expression of APEX2 in E. coliDepositorInsertAPEX2
Tags6xHis and V5ExpressionBacterialPromoterT7 promoterAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7s-WPRE (AAV Retrograde)
Viral Prep#104487-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-jGCaMP7s-WPRE (#104487). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7s-WPRE plasmid DNA. Synapsin-driven GCaMP7s calcium sensor. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV-VPR-S-L1-dCjCas9 MiniCAFE
Plasmid#169910PurposeExpression of a truncated VPR-dCjCas9 fusion protein to activate gene expression.DepositorInsertMiniCAFE
UseCRISPRExpressionMammalianMutationD8A, HNH-truncation (Δ495–609 aa) in CjCas9PromoterCMVAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FlpO (AAV Retrograde)
Viral Prep#183412-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-CAG-FlpO (#183412). In addition to the viral particles, you will also receive purified pAAV-CAG-FlpO plasmid DNA. CAG-driven expression of the recombinase FlpO. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-N-Flag-SREBP2
Plasmid#134284PurposeExpresses Flag-tagged SREBP2 in mammalian cellsDepositorInsertSREBP2 (Srebf2 Mouse)
TagsFlagExpressionMammalianMutationmouse SREBP2 precursorPromoterCMVAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-coilin
Plasmid#36906DepositorAvailable SinceFeb. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA(BbsI)-PGKpuro2ABFP
Plasmid#50946PurposeAn empty gRNA expression vectorDepositorInsertNone
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
ABE8.20-NG
Plasmid#226857PurposeExpresses ABE8.20-NG base editor in mammalian cells with eGFP markerDepositorInsertABE8.20-NG
ExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-NPM WT
Plasmid#17578DepositorAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
-
pCMV-HA_N-human Prkd2
Plasmid#137850PurposeExpress Prkd2 in mammalian cellsDepositorAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEvol-MjaYRS
Plasmid#153557PurposeAmber suppression for incorporating 3-aminotyrosine to proteins in E. coliDepositorInsertsMJaYRS (first copy)
MJaYRS (second copy)
amber suppression tRNA under proK promoter
ExpressionBacterialPromoterglnS and pBADAvailable SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
GreenGate 2.0 Toolkit
Plasmid Kit#1000000241PurposeThe GreenGate 2.0 (GG2.0) toolkit enables the assembly and stacking of complex transcriptional units with the GreenGate Cloning System. It is backwards compatible with most existing GreenGate modules.DepositorAvailable SinceApril 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
N8his-GFPenhancer-GGGGS4-LaG16
Plasmid#140442PurposeWe designed a flexible linker to connect two types of anti GFP nanobodies and used this fusion nanobody to purify GFP tagged protein.DepositorInsertGFPenhancer-GGGGS4-LaG16
Tags8 histidine tagExpressionBacterialPromoterT7 promotorAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-sgRNA(MS2)
Plasmid#102560PurposePiggybac transposon sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR; Piggybac transposonExpressionMammalianPromoterU6Available SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7s-WPRE (AAV1)
Viral Prep#104491-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP7s-WPRE (#104491). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7s-WPRE plasmid DNA. Synapsin-driven, Cre-dependent, GCaMP7s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAVU6+27-F30-2xdBroccoli
Plasmid#66842PurposeExpresses two dimeric Broccoli aptamers in the F30 scaffold in mammalian cellsDepositorInsertTwo dimeric Broccoli aptamers in the F30 scaffold
ExpressionMammalianPromoterU6Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRT
Plasmid#120274PurposeTA-cloning vector of PCR-productsDepositorTypeEmpty backboneAvailable SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-4EBP1 F113A
Plasmid#81122Purposeexpresses a constitutively active mutant of 4E-BP1 under the CAG promoterDepositorAvailable SinceSept. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFRT/FLAG/HA-DEST QKI
Plasmid#19891DepositorAvailable SinceDec. 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Brainbow3.0
Plasmid#45176DepositorInsertpCAG-Brainbow3.0
ExpressionMammalianAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHR-CMV-TetO2_3C-Twin-Strep_IRES-mRuby2
Plasmid#113885PurposeMammalian (inducible) protein expression, bicistronic expression of cytosolic mRuby2DepositorTypeEmpty backboneUseLentiviralTags3C-Twin-StrepPromoterCMV-MIE-TetO2Available SinceAug. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSGNluc
Plasmid#186705PurposeA high-sensitivity bi-directional reporter to monitor NF-κB activity in cell culture and zebrafish in real timeDepositorInsertsGFP
luciferase
Available SinceSept. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
miniCGBE1-SpRY (pBM1571)
Plasmid#170105PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-SpRY-nCas9(D10A)-P2A-EGFPDepositorInsertrAPOBEC1(R33A)-SpRY-nCas9(D10A)-P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationR33A in rAPOBEC1 and SpRY-nCas9 (D10A/A61R/L1111R…PromoterCMVAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFH2.10_Gag-MCP-P2A-eGFP
Plasmid#205525PurposeExpress HIV Gag-MCP-P2A-eGFPDepositorInsertGag-MCP
ExpressionMammalianMutationWTPromoterCMVAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1C-YFP
Plasmid#139646PurposeReplacing the RSV promoter of pLKO.1 with the CMV promoter improves lentiviral production with third-generation viral packaging system.DepositorInsertstuffer
UseLentiviral and RNAiExpressionMammalianMutationSee Depositor commentsPromoterCMVAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pON.mCherry
Plasmid#84821PurposeConstitutive Expression plasmid with mCherry fluorescent proteinDepositorInsertmCherry
ExpressionBacterialPromoterTac PromoterAvailable SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_HuC
Plasmid#65756Purposeexpresses FLAGHA-tagged HuC in mammalian cellsDepositorAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-EGFP (AAV8)
Viral Prep#50469-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-CaMKIIa-EGFP (#50469). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-EGFP plasmid DNA. CamKIIa-driven EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsEGFPAvailable SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta/alpha into TRAC HDRT Source (pTR 169)
Plasmid#112021PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-alphaDepositorInsertNYESO beta/alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceSept. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRPF185
Plasmid#106367PurposeC. difficile inducible expression system. Shuttle plasmid containing a tetracycline-inducible gusADepositorInsertTerm(fdx)-Ptet-gusA-Term(slpA) (gusA )
UseE. coli - c. difficile shuttle vectorMutationcodon optimised for C. difficilePromoterPtetAvailable SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only