We narrowed to 10,034 results for: Pol
-
Plasmid#167452PurposeExpresses C.elegans PUP-2 linked to RNA-recognition motifs (RRMs) of yeast poly(A)-binding protein [PUP alone (+PAB)] from the TEF1 promoterDepositorInsertPTEF1_yeGFP_scPAB14RRMS_cePUP-2_URA3_TADH1
ExpressionYeastPromoterTEF1AvailabilityAcademic Institutions and Nonprofits only -
pHCMM2
Plasmid#167453PurposeExpresses C.elegans PUP-2 linked to RNA-recognition motifs (RRMs) of yeast poly(A)-binding protein [PUP alone (+PAB)] from the Sec63 promoterDepositorInsertPSEC63_yeGFP_scPAB14RRMS_cePUP-2_URA3_TADH1
ExpressionYeastPromoterPSEC63AvailabilityAcademic Institutions and Nonprofits only -
EC1000
Bacterial Strain#71852PurposeRepA+ MC1000, KmR , carrying a single copy of the pWV01 repA gene in the glgB gene; host for pOR128-based plasmidsDepositorBacterial ResistanceKanamycinAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-CoRESTfl
Plasmid#109156PurposeEncodes human full-length CoREST with C-terminal 3xFLAG tag to be expressed in a baculovirus/insect cell expression systemDepositorInserthuman full-length CoREST, sequence-optimized for insect cells (RCOR1 Human)
Tags3xFLAGExpressionInsectPromoterPolyhedrinAvailable SinceJan. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
His-GFP-Clathrin
Plasmid#170858PurposeMammalian expression of His-GFP-Clathrin.DepositorInsertClathrin light polypeptide (Lca) (Clta Mouse)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2,0_3M5M_eGFP
Plasmid#135474PurposeEncodes Marburg virus minigenome with eGFP reporter gene under control of a T7 RNA polymerase promoterDepositorInsertMarburg virus minigenome, eGFP reporter
ExpressionMammalianMutationNonePromoterT7Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2,0_3M5M_luciferase
Plasmid#135475PurposeEncodes Marburg virus minigenome with luciferase reporter gene under control of a T7 RNA polymerase promoterDepositorInsertMarburg virus minigenome, luciferase reporter
ExpressionMammalianMutationNonePromoterT7Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
mRFP-LAP2β
Plasmid#228029Purposelentiviral construct for mRFP-LAP2β expressionDepositorAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
PhyB-mCherry-Spc72
Plasmid#51582PurposeConstitutively express spindle pole body localized PhyB in Saccharomyces cerevisiaeDepositorInsertPhyB (PHYB Mustard Weed)
TagsSpc72 and mCherryExpressionYeastMutation1-908aa onlyPromoterADH1prAvailable SinceAug. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222-SIN3B-3xFLAG
Plasmid#109214PurposeEncodes human full-length SIN3B with a C-terminal 3xFLAG tag to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB
Plasmid#52889Purpose"CoinFLP-Gal4" - Expresses Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express Gal4, or FRT3-FRT3 pair to prevent Gal4 expressionDepositorInsertGal4 (GAL4 Budding Yeast)
ExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
AY27_pU6.gRNA.CLYBL
Plasmid#199238PurposeExpression construct encoding a S. pyogenes guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. pyogenes gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAV5B+longBRD4
Plasmid#157792PurposeExpression of long isoform of BRD4DepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-TREG3G-PE2-rtTA3G-P2A-eGFP
Plasmid#196971PurposePiggybac vector with doxycyclin-inducible prime editor for mammalian cellsDepositorInsertsCas9-RT
rtTA3G-P2A-eGFP
ExpressionMammalianPromoterPGK and TREG3GAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCB’
Plasmid#162703PurposepCB reconstructed after selection for CCMB1 growth on glycerol under ambient airDepositorInsertpHnCB10 derived carboxysome operon, prk
ExpressionBacterialMutation5513T>G (tetR E37A); 7758G>T (second tet op…PromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV GAG
Plasmid#234992PurposeFor production of Viral like particles (VLPs) by expressing the MLV GAG protein in mammalian cellsDepositorInsertGAG
ExpressionMammalianMutationDeleted polymerase coding sequenceAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-eIF3b
Plasmid#240025PurposeHuman eIF3b for further cloning or expression in insect cells for purificationDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOCC175
Plasmid#118890Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6-MBP tag, cleavable with 3C, and N-terminal monomeric GFP, cleavable with TEVDepositorInsertNcoI-HIS6-MBP-3C-mGFP-TEV-NotI-ccdB-AscI-stop-HindIII cassette
TagsHIS6-MBP, cleavable with 3C protease; mGFP, cleav…ExpressionInsectPromoterpolHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1NF
Plasmid#175279PurposeAAV vector mediating inducible expression of the NS1 gene of YFV-17DDepositorAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
IL2 F42A pAcGP67a
Plasmid#41807DepositorInsertIL2 (IL2 Human)
Tags6x HisExpressionInsectMutationPhenylalanine 42 to AlaninePromoterPolyhedronAvailable SinceJan. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAcGP67A-hBAI3-HormR-GAIN
Plasmid#37848DepositorInsertBAI3 (BAI3 Human)
UseBaculovirus transfer vectorsTags8xHISMutationHormR and GAIN domains only (aa498–868PromoterPolyhedrinAvailable SinceJuly 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET29b-AviTag-eGFP-dspB(E184Q W330Y)-6xHis
Plasmid#175801PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein eGFP-DspB(E184Q W330Y), used as a non-binding control for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsAviTag, Hexahistidine tag, and eGFPExpressionBacterialMutationE184Q W330YPromoterT7Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBacDual with LFn + Needle
Plasmid#84868PurposeBaculovirus Expression of LFn-Needle fusion. The LFn domain acts as a signal sequence that targets proteins for cytosolic translocation via the co-administered protective antigen (PA) channel proteinDepositorInsertsLFn
Needle
UseBaculovirusTags6xHisExpressionInsectPromoterPolyhedrinAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-P2A-PuroR
Plasmid#196962PurposeExpresses PE2 with puromycin resistanceDepositorInsertPE2-P2A-Puro
ExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBabePuro-ApoECDS
Plasmid#42949DepositorAvailable SinceMarch 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pB_tetO7_sfGFP
Plasmid#196616PurposePlasmid for integrating tetO7-controlled sfGFP into the HO region in yeastDepositorInsertSuperfolder GFP
ExpressionYeastPromotertetO7 promoterAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GA-CAG Donor
Plasmid#241374PurposeBxb1-GA donor plasmid with CAG promoter, WPRE and polyA signal for constitutive transgene expression (empty)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-iLIDx6
Plasmid#103779Purposeexpresses iPOLYMER component in mammalian cellsDepositorInsertmCherry-iLIDx6
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAW212
Plasmid#172196PurposeP1 integration cassette for AT110 Polymerase for integration onto Orthorep for Nanobody evolution with different restriction sitesDepositorInsertp10B2-AT110
ExpressionYeastPromoter10B2 (P1 specific promoter)Available SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
cyto-YFP-FKBPx5
Plasmid#103777Purposeexpression of iPOLYMER component in mammalian cells; has nuclear exclusion sequenceDepositorInsertcyto-YFP-FKBPx5
ExpressionMammalianPromoterCMVAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-BNT162b2ΔUTR
Plasmid#171214PurposeGateway entry vector containing the BNT162b2/tozinameran cDNA sequence lacking the original 5' and 3' UTRs and the poly(A) tail. The original Kozak sequence has also been altered.DepositorInsertBNT162b2ΔUTR
UseGateway CloningMutationKozak sequence changed from CCCGCCACC to GGCTGCAC…Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSmart-Kan-HC-EF1a-Nla-Cas8-7-5-11
Plasmid#193752Purposehuman codon optimized Nla-cas8c-Cas7c-Cas5c-Cas11c cloned into pSmart-HC-Kan-EF1a-bGHDepositorInsertEF1a-NlaCas8c-Cas7c-Cas5c-Cas11c-bGH PolyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
AV44_pCAG.Cas9-D10A.gRNA.S1
Plasmid#199258PurposeExpression construct encoding SpCas9-D10A nickase and an AAVS1-targeting guide RNADepositorInsertsSpCas9-D10A nickase
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianMutationD10APromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac HT JS-Rab10wt
Plasmid#135557PurposeExpress mouse Rab10wt in Sf9 cells, the resulted plasmid encodes an N-terminally His6-tagged Munc18c protein with a tobacco etch virus (TEV) cleavage site between the His6 tag and Rab10wt.DepositorAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
AV13_pCAG.Cas9.gRNA.NT
Plasmid#199260PurposeExpression construct encoding SpCas9 nuclease and a control non-targeting guide RNADepositorInsertsSpCas9 nuclease
Non-targeting (NT) control gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
p20 Inducible TFs for G-integration: Lex-ER-B112 and ZPM
Plasmid#183150PurposeExpression cassettes for transcription factor induced by estradiol (Lex-ER-B112) or progesterone (ZPM)DepositorInsertsLex-ER-B112
Zif268 DBD - hPRLBD - MSN2AD
UseFor yeast genomic integrationAvailable SinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
IMPT-10316:GABR1
Plasmid#157850PurposeHA-TEV-VFT-TMD-CC-PreX-eGFP in pFastBac1 for Sf9 expressionDepositorAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-GST-TBK1
Plasmid#221331PurposeTBK1 protein overexpression in Sf9 insect cellsDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only