We narrowed to 10,034 results for: Pol
-
Plasmid#28085DepositorInsertZinc finger array targeting vipr1 (LOC100334247 Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
MTS-DDX28(IDR)-mCh-CRY2olig
Plasmid#241146PurposeExpresses mt-optoIDR with DDX28 (1-127 aa) to optogenetically induce biomolecular condensates within mitochondrial matrix in living cells.DepositorInsertDDX28 (DDX28 Human)
TagsmCherry-Cry2oligExpressionMammalianMutationamino acids 1-127 onlyPromoterCMVAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHalo2X-mMYO7A-ΔSH3-ΔM/F2
Plasmid#251427PurposeMammalian expression vector for expressing HaloTag-fused mouse MYO7A truncated after the first MyTH4-FERM domainDepositorInsertMyosin VIIa (SH3 and M/F2 trancated) (Myo7a Mouse)
TagsHaloTagExpressionMammalianMutationThe SH3 and M/F2 domains trancatedAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHalo2X-mMYO7A-RK/AA
Plasmid#251426PurposeMammalian expression vector for expressing a HaloTag-fused mouse MYO7A mutant that destabilizes the autoinhibitory conformation.DepositorInsertMyosin VIIa (RK/AA) (Myo7a Mouse)
TagsHaloTagExpressionMammalianMutationTwo missense mutations in the RGSK motif of the s…Available SinceMarch 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
GFP-LacI-Cyclin B1 ND
Plasmid#234706Purposeallows tethering of non degradable (ND) cyclin B1 protein to lacO repeats in specific chromatin lociDepositorAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC7 CD
Plasmid#224345PurposeExpresses human KDAC7 (HDAC7) catalytic domain in insect cellsDepositorInsertKDAC7 (HDAC7 Human)
TagsTEV-cleavable His6ExpressionInsectMutationOnly includes residues 521-942 (catalytic domain).PromoterPolyhedrinAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFB1.HMBP.PrS.CBX8ΔChromo
Plasmid#224708PurposeExpresses a human CBX8 truncation (deletion of the chromodomain) in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tagDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL.mEGFP-CBX8
Plasmid#224710PurposeExpresses N-terminal hexahistidine-tagged human CBX8 in insect cells, with a monomeric variant EGFP tag.DepositorAvailable SinceOct. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFB1.HMBP.PrS.CBX8
Plasmid#224707PurposeExpresses human CBX8 in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003.gEZH2
Plasmid#220318PurposeExpresses guide RNA for CRISPR/Cas9 knockout of EZH2 for knockout/rescue experiments in mammalian cells.DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-mFzd4-opt(40-537)-9xHis_pFastBac1
Plasmid#216378PurposeBaculovirus transfer vector to express FLAG-tagged mouse Fzd4 (codon-optimized for insect cell expression)DepositorInsertFrizzled-4 (Fzd4 Mouse)
UseBaculovirusTagsHA signal sequence-FLAGExpressionInsectPromoterPolyhedrinAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-POWV_NS2B-GS-NS3
Plasmid#203471PurposeExpresses POWV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-LGTV_NS2B-GS-NS3
Plasmid#203468PurposeExpresses LGTV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-ZIKV_NS2B-GS-NS3
Plasmid#203477PurposeExpresses ZIKV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR/D-Topo CDS A. thaliana IMPORTIN ALPHA 2
Plasmid#175816PurposepENTR plasmid with CDS of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 2 (AT4G16143.1) without stop codon for C-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 2 (IMPA-2 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnoneMutationnatural polymorphism P65S, annotated in Genbank f…PromoternoneAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
p35S_GFP-EVDinter-GUS
Plasmid#167123PurposePlant binary expression vector containing the intron and proximal polyadenylation signal sequences of the Copia93 retroelement EVADE (AT5G17125) between mGFP5 and GUS under CaMV 35S promoter.DepositorInsertEVADE GAG intron and terminator (EVD_in/ter) (AT5G17125 Mustard Weed)
TagsGUS and mGFP5ExpressionPlantPromoterCaMV 35SAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc sfCherry2ΔC4-Lifeact
Plasmid#231557PurposeMammalian expression of Lifeact fused to C-terminally truncated superfolder Cherry2, for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hPPP3CA-FLAG
Plasmid#179134PurposeExpression vector of human protein phosphatase 3, catalytic subunit, alpha isoform (PPP3CA) tagged with FLAG at C-terminus, CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, catalytic subunit, alpha isoform (PPP3CA Human)
TagsFLAGExpressionMammalianAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MH6-Bsu
Plasmid#163911PurposeExpresses Bsu large fragment for affinity purificationDepositorInsertBsu polymerase
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.neo_shGFP
Plasmid#110470PurposeControl, silence GFP gene, doxycycline inducible, neomycin selectionDepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Myo10
Plasmid#135403PurposeExpresses GFP-tagged bovine Myo10 in mammalian cells.DepositorInsertMyo10 (MYO10 Bovine)
TagsEGFPExpressionMammalianMutation"Relative to the GenBank Myo10 cDNA sequence…PromoterCMVAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTol2-HuC(elavl3)-CaMPARI2
Plasmid#137185Purposepan-neuronal expression of CaMPARI2 in zebrafish, used to generate the CaMPARI2 zebrafish line at ZIRC (ZL13801)DepositorInsertHuC(elavl3)-CaMPARI2-FLAG-HA-myc-polyA
UseTol2 plasmid for zebrafishTagsFLAG, HA, mycPromoterHuC(elavl3)Available SinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB–DualPE
Plasmid#235161PurposeFor plant prime editing including large DNA fragment editing in wheat plants or other monocotyledonsDepositorInsertsCsy4-P2A-Nls-nCas9-NC-nls-MLV-Nls
CmYLCV-epegRNA-CaMV poly(A) signal
UseCRISPRMutationDetailed in manuscriptAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSSRB069_pAC8-hsDDB1dB
Plasmid#218790PurposeInsect cell expression vector for 6xHis-TEV-hsDDB1∆BDepositorInsertDNA damage-binding protein 1 (DDB1 Human)
Tags6xHis-TEVExpressionInsectMutationDeleted amino acids 396-705 and replaced with GNG…PromoterpolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGS_101
Plasmid#160541PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGS_107
Plasmid#160650PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-POMP-PSMG1-PSMG2-PSMG3-PSMG4
Plasmid#214137PurposeInsect cell expression of the human 20SCP proteasome assembly chaperonesDepositorInsertsExpressionInsectPromoterpolyhedrinAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-M13-6His-KIF1C-GFP
Plasmid#130975PurposeExpression of 6His-KIF1C-GFP in insect cells for protein purification.DepositorInsertKIF1C-GFP (KIF1C Human)
Tags6His and GFPExpressionInsectMutation5 silent mutations that make this construct RNAi …PromoterPolyhedrinAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSSRB274_pAC8-eGFP-hsCRBN
Plasmid#218791PurposeInsect cell expression vector for FLAG-TEV-eGFP-Prescission-hsCRBNDepositorInsertProtein cereblon (CRBN Human)
TagsFLAG-TEV-eGFP-PrescissionExpressionInsectMutationeGFP fused to N-terminusPromoterpolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTRF/Cavin1_R (OZ514)
Plasmid#27189DepositorInsertZinc finger array targeting PTRF/Cavin1 (cavin1b Zebrafish)
UseZebrafish targetingAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-shBIRC6-2
Plasmid#202449PurposeDOX-inducible expression of a short-hairpin RNA targetinging human BIRC6DepositorAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFL-EGFP-3xFlag-HLTF
Plasmid#193055PurposeBaculovirus expression of human HLTF for recombinant protein productionDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSDC803_IKZF1_mutant
Plasmid#224113PurposeInsect cell expression vector for IKZF1 mutant for CRBN cryoEM pre-blottingDepositorInsertIKZF1 (IKZF1 Human)
TagsFlag-TEVExpressionInsectMutationResidues 140-196, Q146A and G151NPromoterpolyhedrinAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGHUC w-ERBIN (2-hybrid prey plasmid)
Plasmid#128163PurposeUV5 promoter drives expression of omega-erbin fusion. Pair with pB1H2 UV5 Zif268-cons as a positive control (turns on HIS3/GFP).DepositorInsertERBIN PDZ domain (ERBIN Synthetic)
UseSynthetic BiologyTagsFLAG and Omega subunit of RNA polymeraseExpressionBacterialPromoterUV5Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDHa_mDDX5_FL_wt
Plasmid#88869Purposeconstitutive expression of Ha-DDX5 in mammalian cellsDepositorAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-GFP-dynein-2(D1091–Q4307)
Plasmid#64064PurposeCodon-optimized human dynein-2 motor domain (D1091–Q4307) for baculovirus expression. 6His-ZZ-GFP N-terminal tag, TEV site to cleave 6His-ZZ.DepositorInsertCytoplasmic dynein-2 (DYNC2H1 Human)
TagsGFP, His tag, and ZZ tagExpressionInsectMutationDeleted amino acids 1-1090, extra C-terminal vali…PromoterPolyhedrinAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHIV-EGFP.Flag-EZH2-mt2
Plasmid#220245PurposeExpresses an EZH2 mutant for knockout/rescue experiments in mammalian cells.DepositorInsertEZH2 mt 2 (EZH2 Human)
UseLentiviralTagsFlagExpressionMammalianMutationF32A, R34A, D36A, K39A, PRKKKR494-499NAAIRSPromoterEF-1αAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSN840
Plasmid#184832PurposeExpresses human KIF5A(∆exon27) and human KLC1 in insect cellsDepositorUseCre/LoxTagsHis-FLAG and mScarlet-2xStrepIIExpressionInsectMutation∆exon27 form of human KIF5APromoterp10 and polyhedrinAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only