We narrowed to 8,876 results for: sgrna
-
Plasmid#208382PurposeDerived from LentiCRISPRV2 by replacing Cas9 with Cre recombinase and puromycin resistance with GpNLuc. Contains a stuffer sequence for cloning of sgRNA of interest, as per LentiCRISPRV2.DepositorTypeEmpty backboneUseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only
-
U6-(BbsI)sgRNA_CAG-Venus-bpA
Plasmid#86985PurposeFor cloning and expression of sgRNA together with Venus expressionDepositorInsertVenus
ExpressionMammalianMutationVenus GFP variantPromoterCAGAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8
Plasmid#71828PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and specific sgRNA for targeted DNA methylation of BACH2 promoter in human cells; for use as a controlDepositorInsertBACH2-sgRNA8 (BACH2 S. pyogenes, Synthetic, Human)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZ148-BhCas12b-sgRNA-scaffold
Plasmid#122448PurposeExpresses sgRNA for BhCas12b in mammalian cellsDepositorInsertU6-BhCas12b-sgRNA-scaffold, CMV-mCherry
ExpressionMammalianAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHKMC1: Empty sgRNA for Cloning
Plasmid#67720PurposeEmpty vector for cloning sgRNA. NotI and BamHI for cloning sgRNA. PU6 driven sgRNA.DepositorTypeEmpty backboneExpressionWormPromoterPU6Available SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNA500
Plasmid#149576Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCV(W-)U6sgRNA5(BbsI)-PGKpuroBFP
Plasmid#102797PurposeRetrovirus for testing CRISPR KO activity (empty) - non-targeting control plasmid contains GFP instead of PuroRDepositorInsertssgRNA
EGFP
UseCRISPR and RetroviralExpressionMammalianMutationH231LAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA2
Plasmid#99735PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L3L2
Plasmid#113740PurposeGateway entry vector containing attL3 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1L4
Plasmid#113736PurposeGateway entry vector containing attL1 and attL4 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-TRAF6-targeting sgRNA 1
Plasmid#131345PurposegRNA targeting mouse TRAF6DepositorAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1192-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS
Plasmid#129530PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3NmeDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMulti-sgRNA-LacZ-DsRed
Plasmid#99914PurposeReceptor plasmid for the assembly of multiple sgRNAs with DsRed coexpressionDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hPER2c-term #1
Plasmid#179454PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hPER2c-term #2
Plasmid#179455PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hPER2c-term #3
Plasmid#179456PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV U6-sgRNA UbC-tdTomato
Plasmid#106949PurposesgRNA cloning cassette using BsmBI/Esp3I enzymes with tdTomato markerDepositorInsertsgRNA BsmBI/Esp3I cloning site
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1L2
Plasmid#113735PurposeGateway entry vector containing attL1 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
p1194-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIA4_FLAG_NLS
Plasmid#129532PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIA4DepositorInsertscodon-optimized AcrIIA4
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZ147-BvCas12b-sgRNA-scaffold
Plasmid#122447PurposeExpresses sgRNA for BvCas12b in mammalian cellsDepositorInsertU6-BvCas12b-sgRNA-scaffold, CMV-mCherry
ExpressionMammalianAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-MS2-PP7
Plasmid#75392PurposesgRNA1-MS2-PP7DepositorInsertsgRNA1-2XMS2-PP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-PP7-boxB
Plasmid#75393PurposesgRNA1-PP7-boxBDepositorInsertsgRNA1-2XPP7-boxB
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-TRAF6-targeting sgRNA 2
Plasmid#131346PurposegRNA targeting mouse TRAF6DepositorAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L5L2
Plasmid#113738PurposeGateway entry vector containing attL5 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Expression scaffold for dCas9+sgRNA
Plasmid#171799PurposePICASSO: Expression scaffold for second subcloning step to properly co-express paired dCas9-fusion+sgRNADepositorInsertPICASSO: expression scaffold for proper dCas9-fusion + sgRNA expression
UseCRISPRAvailable SinceAug. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-R4R3
Plasmid#113739PurposeGateway entry vector containing attR4 and attR3 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L5L4
Plasmid#113741PurposeGateway entry vector containing attL5 and attL4 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1R5
Plasmid#113737PurposeGateway entry vector containing attL1 and attR5 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-RPB1-N-term
Plasmid#195111PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_Tet-inducible Luciferase reporter
Plasmid#64161PurposePhotoactivatable transcription system. Mammalian expression of sgRNA1 to target Tet-inducible-luciferase reporter.DepositorInsertsgRNA1 for Tet-inducible Luciferase reporter
UseCRISPRExpressionMammalianPromoterhuman U6Available SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV U6-sgRNA UbC-GFP
Plasmid#106948PurposesgRNA cloning cassette using BsmBI/Esp3I enzymes with GFP markerDepositorInsertsgRNA BsmBI/Esp3I cloning site
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hCYP3A4_enhancer_guide1
Plasmid#176839PurposeTo recruit SAM complex to human CYP3A4 proximal enhancer.DepositorInsertHuman CYP3A4 proximal enhancer sgRNA for activation
ExpressionMammalianPromoterU6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-tomato-TSC2-sgRNA
Plasmid#196195PurposeEditing human TSC2 locusDepositorInsertTSC2 (TSC2 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A2NT
Plasmid#62257Purposeexpression of A2NT sgRNA from the arabinose-inducible promoterDepositorInsertA2NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-boxB-MS2
Plasmid#75396PurposesgRNA1-boxB-MS2DepositorInsertsgRNA1-boxB-MS2
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9 EMX1-nicking sgRNA
Plasmid#169859PurposeSpyCas9 nicking sgRNA for EMX1DepositorInsertSpyCas9 EMX1-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-2-RPB1-C-term
Plasmid#195109PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 C-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against last exon of RPB1 (C-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-Puro HLAG-2A-sgRNA
Plasmid#182551PurposeCas9 from S.pyogenes with 2A-Puro, and the 2A-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2A-sgRNA
UseCRISPRExpressionMammalianPromoterCbhAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only