-
Plasmid#205020PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorA signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorA-mNeonGreen
UseTagsExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable sinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMH0006
Plasmid#135448PurposeHuman expression vector containing Ubiquitous Chromatin Opening Element (UCOE) upstream of EF1alpha promoter, dCas9 that is fused to NLS, tagBFP and a KRAB domain.DepositorInsertdCas9-BFP-KRAB
UseLentiviralTagstagBFPExpressionMammalianMutationPromoterEF1AAvailable sinceJuly 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
RANLS-DEVD-BNES
Plasmid#50840PurposeExpresses a tandem ddFP heterodimer in mammalian cells, plasmid 1 for a translocation-based red fluorescent caspase-3 biosensor, used together with plasmid 2 (BNLS).DepositorInsertddRFP A and ddRFP B
UseTagsNES sequence LALKLAGLDIGS and triplicated NLS seq…ExpressionMammalianMutationPromoterCMVAvailable sinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
Villinpromoter-blue-FlpOERT2
Plasmid#67278Purpose4hydroxytamoxifen inducible FlpO recombinase controlled by intestine specific promoter (Villin). FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon contextDepositorInsertmTQ2=mturquoise2 blue fluorescent gene
UseTagslinked to FlpO through an P2A ribosomal skipping …ExpressionMutationPromoterVillinAvailable sinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
eMscL WT
Plasmid#107454PurposeeMscL WT is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motifDepositorInsertbacterial mechanosensitive ion channel of large conductance (mscL Escherichia Coli)
UseAdeno-associated viralTagsKir2.1 ER export signal (FCYENEV) and tdTomato fl…ExpressionMammalianMutationPromoterhuman synapsin 1Available sinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHtrA-TEV-His12
Plasmid#137036Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi HtrA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66500.2 (BB_0104 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMuLE_EXPR_CMV-eGFP_TOP-NLuc1.1_12GLI-FLuc_CBF-GLuc
Plasmid#113862PurposeTriple pathway reporter, 3P-Luc; wnt-NLuc1.1, hedgehog-FLuc, notch-GLuc; plus CMV-eGFP. Gateway expression vector for lentivirus generation.DepositorInsertsCMV-eGFP
TOP-NLuc1.1
12GLI-Fluc
CBF-GLuc
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDipA-TEV-His12
Plasmid#137042Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi DipA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66790.1 (BB_0418 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
GANES-DEVD-BNLS
Plasmid#50842PurposeExpresses a tandem green ddFP heterodimer in mammalian cells, construct 1 for a green to red colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid RANLS.DepositorInsertddGFP A and ddGFP B
UseTagsNES sequence LALKLAGLDIGS placed after ddGFP A an…ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pELPS-eDHFR-YFP-T2A-Renilla
Plasmid#193253PurposeTriple reporter plasmid in pELPS with eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferaseDepositorInsertThe eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferase
UseLentiviralTagsRenilla luciferase (rLuc) and yellow fluorescent …ExpressionMutationNonePromoterEF1aAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
NESRA-DEVD-BNLS
Plasmid#50849PurposeExpresses a tandem red ddFP heterodimer in mammalian cells, construct 1 for a red to green colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid GANLS.DepositorInsertddRFP A and ddRFP B
UseTagsNES sequence LQKKLEELELDE placed after ddGFP A an…ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCyCEN_Lisp2mCherry_hsp70_GFP
Plasmid#137169PurposeDual fluorescent reporter for liver stage expression in Plasmodium cynomolgiDepositorInsertsmCherry
Nanoluc
dihydrofolate reductase
Green Fluorescent Protein
UseUnspecifiedTagsT2AExpressionMutationPromoterP. cynomolgi hsp70 and P. cynomolgi lisp2Available sinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBBA57-TEV-His12
Plasmid#137033Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BBA57 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66270.1 (BB_A57 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length BBA57, contains signal pep…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/mEGFP-1T-IRES-mCherry
Plasmid#190190PurposeLentiviral expression vector with altered Kozak sequence to direct EGFP expression. mCherry expression is regulated by an IRES.DepositorInsertsmEGFP
mCherry
UseLentiviralTagsExpressionMutationchanged EGFP Kozak sequence inserting a C>T mo…PromoterEIF1-shortAvailable sinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorT(sp)-mNeonGreen
Plasmid#205021PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorT signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorT-mNeonGreen
UseTagsExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable sinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSET-XS-VWF
Plasmid#64847PurposeExpresses aa1594–1670 of VWF A2 domain flanked by Venus and Cerulean and tagged with 7X His at C terminusDepositorInsertVenus_VWF A2 domain aa 1594-1670_Cerulean_TEV_7X His (VWF Synthetic, Human)
UseTags7X His, Cerulean, and VenusExpressionBacterialMutationPromoterT7Available sinceMay 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Farnesyl-5
Plasmid#55481PurposeLocalization: Plasma Membrane, Excitation: 462, Emission: 492DepositorInsertFarnesyl (HRAS Human)
UseTagsmTFP1ExpressionMammalianMutationencodes final 20 aa of NM_001130442.1PromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-MAPTau-N-10
Plasmid#55498PurposeLocalization: Microtubules, Excitation: 462, Emission: 492DepositorInsertMAPTau (MAPT Human)
UseTagsmTFP1ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP4A 153-222
Plasmid#108256PurposeExpresses C-terminal 153-222 residues of CHMP4A with non-native N-term cysteine for fluorescent labeling; Internal ID: WISP18-6DepositorInsertCHMP4A residues 153-222 (CHMP4A Human)
UseTagsHis-SUMOExpressionBacterialMutationContains nonnative Gly-Cys for fluorescent labeli…PromoterT7Available sinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCapVQ329R
Plasmid#183029Purposethe patatin-like phosphodiesterase CapV variant CapVQ329R cloned in the L-arabinose inducible vector pBAD28DepositorInsertpatatin-like phospholipase variant CapVQ329R
UseTagsNoExpressionBacterialMutationglutamine 329 changed to argininePromoterpBAD promoterAvailable sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB120
Plasmid#167150PurposeMoClo-compatible Level 1 (position 1) vector encoding Kanamycin resistance cassette, for expression in plantsDepositorInsertpNOS-nptII-ocsT
UseTagsExpressionPlantMutationPromoterpNOSAvailable sinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBB0405-TEV-His12
Plasmid#137040Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BB0405 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66795.1 (BB_0405 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRevA-TEV-His12
Plasmid#137034Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi RevA with C-terminal TEV-protease-cleavable His12DepositorInsertAAF07416.1 (revA Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pP13-TEV-His12
Plasmid#137035Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi P13 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66426.1 (BB_0034 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
eMscL G22S
Plasmid#107455PurposeeMscL G22S is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motifDepositorInsertbacterial mechanosensitive ion channel of large conductance (mscL Escherichia coli)
UseAdeno-associated viralTagsKir2.1 ER export signal (FCYENEV) and tdTomato fl…ExpressionMammalianMutationBearing a glycine to serine substitution at posit…Promoterhuman synapsin 1Available sinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG106 Lyn11-FAST
Plasmid#130721PurposeExpresses FAST (also called YFAST) fused to Lyn11 sequence in mammalian cellsDepositorInsertlyn11-FAST
UseTagsmyc-tagExpressionMammalianMutationPromoterCMVAvailable sinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLCA.66/2272
Plasmid#22733DepositorInsertLox66-pU(delta)TK-EM7Neo-Lox2272
UseCre/Lox; Bac recombineeringTagsExpressionMutationThis vector was designed for assembling gene targ…PromoterAvailable sinceDec. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAG156 Mito-FAST
Plasmid#130723PurposeExpresses FAST (also called YFAST) fused to a mitochondria targeting sequence (mito) in mammalian cellsDepositorInsertMito-FAST
UseTagsMyc-tagExpressionMammalianMutationPromoterCMVAvailable sinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAG109 H2B-FAST
Plasmid#130722PurposeExpresses FAST (also called YFAST) fused to zebrafish histone H2B in mammalian cellsDepositorInsertH2B-FAST
UseTagsmyc-tagExpressionMammalianMutationPromoterCMVAvailable sinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-BB0323-ss
Plasmid#137067PurposeE. coli expression clone (T7lac promoter) for mature BB0323 (aa 20-377) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAC66700.1
UseTagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationmature BB0323: lacks the BB0323 signal peptidePromoterT7lacAvailable sinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTV001
Plasmid#130265PurposeEatA expression plasmid containing 8His encoding region in permissive site of eatA geneDepositorInserteatA::His8
UseTagspolyhistidine (internal)ExpressionBacterialMutation8His polyhistidine encoding region and XhoI site …PromoteraraBADAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP4C 156-233
Plasmid#108257PurposeExpresses C-terminal 156-233 residues of CHMP4C with non-native N-term cysteine for fluorescent labeling; Internal ID: WISP18-9DepositorInsertCHMP4C residues 156-233 (CHMP4C Human)
UseTagsHis-SUMOExpressionBacterialMutationContains nonnative Gly-Cys for fluorescent labeli…PromoterT7Available sinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP1A 140-196
Plasmid#104593PurposeExpresses C-terminal 140-196 residues of CHMP1A with non-native N-term cysteine for fluorescent labeling; Internal ID: WISP18-1DepositorInsertCHMP1A residues 140-196 (CHMP1A Human)
UseTagsHis-SUMOExpressionBacterialMutationContains nonnative Gly-Cys for fluorescent labeli…PromoterT7Available sinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP2A 152-222
Plasmid#104594PurposeExpresses C-terminal 152-222 residues of CHMP2A with non-native N-term cysteine for fluorescent labeling; Internal ID: WISP18-3DepositorInsertCHMP2A residues 152-222 (CHMP2A Human)
UseTagsHis-SUMOExpressionBacterialMutationContains nonnative Gly-Cys for fluorescent labeli…PromoterT7Available sinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP2B 141-213
Plasmid#104595PurposeExpresses C-terminal 141-213 residues of CHMP2B with non-native N-term cysteine for fluorescent labeling; Internal ID: WISP18-4DepositorInsertCHMP2B residues 141-213 (CHMP2B Human)
UseTagsHis-SUMOExpressionBacterialMutationContains nonnative Gly-Cys for fluorescent labeli…PromoterT7Available sinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP3 159-222
Plasmid#104599PurposeExpresses C-terminal 159-222 residues of CHMP3 with non-native N-term cysteine for fluorescent labeling; Internal ID: WISP18-5DepositorInsertCHMP3 residues 159-222 (CHMP3 Human)
UseTagsHis-SUMOExpressionBacterialMutationContains nonnative Gly-Cys for fluorescent labeli…PromoterT7Available sinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-BB0238-ss
Plasmid#137046PurposeE. coli expression clone (T7lac promoter) for mature BB0238 (aa 21-256) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAC66635.2 (BB_0238 Borrelia burgdorferi B31)
UseTagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationmature BB0238: lacks the BB0238 signal peptidePromoterT7lacAvailable sinceApril 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-P66-ss
Plasmid#137045PurposeE. coli expression clone (T7lac promoter) for mature P66 (aa 22-618) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAC66949.1 (p66 Borrelia burgdorferi B31)
UseTagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationmature P66: lacks the P66 signal peptidePromoterT7lacAvailable sinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3xFLAG-RSL1D1(WT)
Plasmid#122301Purposeexpresses RSL1D1 protein with a flag tagDepositorInsertRSL1D1 (RSL1D1 Human)
UseTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only