We narrowed to 9,057 results for: sgRNA
-
Plasmid#97007PurposeExpresses Cas9 and Rosa26 locus specific sgRNADepositorInsertRosa26 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHelper_ShCAST_sgRNA
Plasmid#127921PurposeExpresses ShCAST and an empty sgRNA scaffold. New targets can be added using Golden Gate assembly (LguI sites).DepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA scaffold for guide cloning (LguI sites)
Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA_expression_vector
Plasmid#210212PurposeAn empty gRNA expression vector to clone U6 promoter driven sgRNAs with gRNA scaffold and with co-expression of DsRed. sgRNA can be cloned by Golden Gate Assembly or restriction digestion using BbsI.DepositorTypeEmpty backboneExpressionBacterial and MammalianPromoterU6Available SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#1
Plasmid#64245Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNAEmptyVector_Puro_T2A_BFP2
Plasmid#236729PurposeDual sgRNA empty vector expressing BFP with Puromycin selectionDepositorTypeEmpty backboneUseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_Puro_T2A_BFP2
Plasmid#236730PurposeDual sgRNA targeting CTRL expressing BFP with Puromycin selectionDepositorInsertNegative CTRL
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.tRFP
Plasmid#169941PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and tRFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6b:sgRNA#3
Plasmid#64247Purposeexpresses sgRNA under U6b promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#2
Plasmid#64246Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pnsgRNA
Plasmid#172717PurposeDelivery of guide RNA for prime editingDepositorInsertJ23119-gRNA
ExpressionBacterialAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6d:sgRNA#5
Plasmid#64249Purposeexpresses sgRNA under U6d promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGH224_sgRNA_2xMS2_Puro
Plasmid#85413PurposehU6 driven sgRNA vector with 2xMS2 vectors with puro selectable markerDepositorInsertpuromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
U6>sgRNA(F+E)
Plasmid#59986PurposeEmpty vector for sgRNA cloning (F+E modified backbone)DepositorTypeEmpty backboneUseCRISPRPromoterCiinte.U6Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCgsgRNA_crtYf
Plasmid#153338PurposeDouble-plasmid-based CRISPR-Cas9 system in Corynebacterium glutamicum; rep oriVC. glutamicum; pMB1 oriVE. Coli; Pj23119-crRNA targeting crtYf; SpcrDepositorInsertcrRNA targeting crtYf
UseCRISPRExpressionBacterialAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSGKP_AcsgRNA
Plasmid#203807PurposepSGKP-based plasmid containing a J23119-driven sgRNA cassette, with replaceable spacer (BsaI-restriction sites). Kanamycin resistance.DepositorInsertAcgRNA
UseCRISPRPromoterJ23119Available SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC2_10_dCas9_VPR_HC_sgRNA
Plasmid#163712PurposeYeast high copy plasmid with dCas9, sgRNA expression cassette and VPR activation domainsDepositorInsertsdCas9
VPR
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos6_AmpR
Plasmid#119149PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanRDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR
UseCrisprAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
SaCas9_sgRNA_expression_in_pBluescript
Plasmid#122090PurposeU6 driven SaCas9 sgRNA expression vector for cloning own guidesDepositorAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_PHF19_sgRNA
Plasmid#246404PurposeCas9/sgRNA expression plasmid targeting PHF19DepositorInsertPHF19 (PHF19 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only