We narrowed to 8,863 results for: sgRNA
-
Plasmid#122091PurposeU6 driven NmCas9 sgRNA expression vector for cloning own guidesDepositorInsertNmCas9 tracrRNA (NEWENTRY Synthetic, S. pyogenes)
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.tRFP
Plasmid#169941PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and tRFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGH224_sgRNA_2xMS2_Puro
Plasmid#85413PurposehU6 driven sgRNA vector with 2xMS2 vectors with puro selectable markerDepositorInsertpuromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
PtPuc3_diaCas9_sgRNA
Plasmid#109219PurposeEpisome based vector with CRISPR/Cas9_sgRNA module for genome editing in Phaeodactylum tricornutumDepositorInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPR and Synthetic BiologyPromoterLHCF1 terminator, LHCF2 promoter, U6 3' regi…Available SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
LCV2_LacZ_sgRNA_2
Plasmid#155093Purposelentiviral plasmid expressing Cas9 and gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos6_AmpR
Plasmid#119149PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanRDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR
UseCrisprAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCnCas12f1HS_sgRNA_MS13_empty
Plasmid#204999PurposeCnCas12f1 with MS13 sgRNA site for Human cell genome editingDepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbPDS
Plasmid#231147PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbPDSDepositorInsertmobile gRNA targeting NbPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EC2_1_dCas9_sgRNA
Plasmid#163710PurposeYeast low copy plasmid with dCas9 and sgRNA expression cassetteDepositorInsertdCas9
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459_MCM2_sgRNA
Plasmid#232730PurposeGenerates MCM2 dTAG C ternimal knock-in cell linesDepositorAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_CDC45_sgRNA
Plasmid#232732PurposeGenerates CDC45 dTAG C ternimal knock-in cell linesDepositorAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_2
Plasmid#155088Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_NT_AmpR
Plasmid#119144PurposeEncodes non-targeting sgRNADepositorInsertnon-targeting sgRNA
UseCrisprAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
SaCas9_sgRNA_expression_in_pBluescript
Plasmid#122090PurposeU6 driven SaCas9 sgRNA expression vector for cloning own guidesDepositorAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.tBFP
Plasmid#169940PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and tBFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIA1
Plasmid#106097PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIA1DepositorInsertgRNA TIA1
UseCRISPRAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
p206_LTJ_sgRNACD45.2_R3
Plasmid#82674PurposesgRNA targeting murine CD45.2 region 3. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting CD45.2 region 3
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_sgRNA
Plasmid#100554PurposeExpresses AAVS1 sgRNA. Target sequence: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
Nme2sgRNA_pLKO
Plasmid#119926PurposeNme2Cas9 U6-driven sgRNA cassetteDepositorInsertNmeCas9 sgRNA
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only