167,785 results
-
Plasmid#232738PurposeExpresses NADPH/NADP+ biosensor NAPstar1 in S. cerevisiae.DepositorInsertNAPstar1
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXJ-Myc-TCF7L2
Plasmid#232644Purposetransient expresses TCF7L2 in mammalian cellsDepositorAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
lvl0-G-CasE
Plasmid#229184Purposelvl 0 5 geneDepositorInsertCasE
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSET A-mEosEM-E
Plasmid#226336PurposePhotoswitchable fluorescent protein for correlative light-electron microscopy; mEosEM-E for prokaryotic expressionDepositorInsertmEosEM-E
TagsHisExpressionBacterialPromoterT7Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-eGFP-msMMS22L
Plasmid#221014Purposemammalian expression vector of eGFP tagged mouse MMS22LDepositorInsertMMS22L (Mms22l Mouse)
TagseGFPExpressionMammalianMutationnaturally siResistant to siMMS22L (human) aagacuu…PromoterCMVAvailable SinceSept. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAVS1 EGFP-LC3B HRD
Plasmid#207551PurposeHomologous recombination donor to integrate and expression cassette for eGFP-LC3B in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-LC3B
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-GABARAPL1 HRD
Plasmid#207552PurposeHomologous recombination donor to integrate and expression cassette for EGFP-GABRAPL1 in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-GABARAPL1
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS_MmaPylT_EF1_NES-MmaPylRS WT
Plasmid#174901Purposeexpression of Mma PylRS with nuclear export sequence for amber suppression in mammalian cells; transient or piggy bac mediated integrationDepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJUMP24_T24_pRham-ilvA-relE
Plasmid#201531PurposeExpressing synthetic overlapping gene, ilvA-relE. Origin pRO1600/ColE1 (E.coli - Pseudomonas shuttle)DepositorInsertilvA-relE
UseSynthetic BiologyPromoterPrhaBAD (rhamnose)Available SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-SEMA3E-Fc(DAPA)-AviTag-6xHis
Plasmid#156970PurposeMammalian expression of secreted protein fused to Fc(DAPA)-Avi-6xHis.DepositorInsertSEMA3E (SEMA3E Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
PL05006A1C09-pc2
Plasmid#26538DepositorInsertprohormone convertase 2
Available SinceNov. 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
PIEZO1-HaloTag
Plasmid#207834PurposePIEZO1 fusion for biochemistry and live imagingDepositorAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFX-Tom20-EGFP
Plasmid#174186PurposeExpress EGFP with mitochondria-targeting sequence in mammalian cellsDepositorInsertEGFP with mitchondria-targeting sequence
Tagsthe mitochondria-targeting sequence of TOM20ExpressionMammalianPromoterCMVAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-G-Flamp2
Plasmid#192782Purposegreen biosensor for cAMP in mammalian cellsDepositorInsertG-Flamp2
TagsHis tagExpressionMammalianPromoterCAGAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-TFEB
Plasmid#38119PurposeMammalian expression of Transcription factor EB fused to EGFPDepositorAvailable SinceJuly 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-EGFP (AAV1)
Viral Prep#50457-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-DIO-EGFP (#50457). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-EGFP plasmid DNA. hSyn-driven, Cre-dependent EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8m-WPRE (AAV PHP.eB)
Viral Prep#162375-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pGP-AAV-syn-jGCaMP8m-WPRE (#162375). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8m-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
4xCSL-luciferase
Plasmid#41726DepositorInsert4xCSL binding sites
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationContains a multimerized high affinity CSL binding…Available SinceDec. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-mt-mKeima
Plasmid#131626Purposelentiviral expression of mitochondrial mKeima for generation of stable cell linesDepositorInsertmt-mKeima
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
tubP-FRT>GAL80-6-FRT>
Plasmid#63173Purposeubiquitous expression of a "flp-Out" Drosophila codon-optimized GAL80 gene cassetteDepositorInsert"Flp-Out" GAL80
ExpressionInsectAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EF1a-Zim3-dCas9-P2A-BFP
Plasmid#188777PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterEF1aAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn Con/Fon hChR2(H134R)-EYFP (AAV5)
Viral Prep#55645-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSyn Con/Fon hChR2(H134R)-EYFP (#55645). In addition to the viral particles, you will also receive purified pAAV-hSyn Con/Fon hChR2(H134R)-EYFP plasmid DNA. Synapsin-driven, Cre-dependent and Flp-dependent channelrhodopsin-EYFP expression for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEYFP (Cre- and Flp-dependent)Available SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
M50 Super 8x TOPFlash
Plasmid#12456PurposeBeta-catenin reporter. TCF/LEF sites upstream of a luciferase reporter.DepositorInsertTCF/LEF binding sites (Ctnnb1 )
UseLuciferaseAvailable SinceMarch 13, 2007AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-hSyn-mCherry (AAV5)
Viral Prep#114472-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSyn-mCherry (#114472). In addition to the viral particles, you will also receive purified pAAV-hSyn-mCherry plasmid DNA. Synapsin-driven mCherry control vector. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT3-N90-beta-catenin
Plasmid#31785DepositorInsertbeta-catenin (CTNNB1 Human)
TagsMycExpressionMammalianMutationDeletion of aa 1-90- Constitutitvely ActivePromoterEF1alphaAvailable SinceOct. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 hygro
Plasmid#24150Purpose3rd gen lentiviral backbone for cloning and expression of new shRNA sequences. Uses hygromycin for selection.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral and RNAiExpressionMammalianPromoterU6 for shRNAAvailable SinceMarch 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ATLASsnCre (AAV5)
Viral Prep#232351-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-ATLASsnCre (#232351). In addition to the viral particles, you will also receive purified pAAV-ATLASsnCre plasmid DNA. Syn-driven, ATLASsnCre expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 (AAV9)
Viral Prep#100842-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 (#100842). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 14, 2018AvailabilityAcademic Institutions and Nonprofits only