-
Plasmid#211535PurposesgRNA-1 against Lig4DepositorInsertsgRNA hLig4 (LIG4 Synthetic)
UseCRISPRTagsExpressionMammalianMutationPromoteru6Available sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-TC9
Plasmid#202088Purposeentry vector for gateway recombination of TevCas9 and sgRNA into a destination cassette in pCitro-destDepositorInsertTevCas9 + sgRNA cassette
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8271 LentiCRISPR v2 hygro sgSIGIRR-4
Plasmid#193980PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHY55-mouse U6-sgLMNA
Plasmid#164045PurposeU6-driven sgRNA targeting LMNADepositorInsertLMNA targeting sgRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF449_dpy-10_CDS_sg1
Plasmid#163866PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRTagsExpressionWormMutationPromoterR07E5.16 (U6)Available sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF328_sqt-3_3′UTR_sg2
Plasmid#163867PurposesgRNA targeting sqt-3 (3′UTR) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the 3'UTR of sqt-3
UseCRISPRTagsExpressionWormMutationPromoterR07E5.16 (U6)Available sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF496_dpy-10_CDS_sg6
Plasmid#164267PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRTagsExpressionWormMutationPromoterR07E5.16 (U6)Available sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF495_dpy-10_CDS_sg6
Plasmid#164268PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJF439.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRTagsExpressionWormMutationPromoterU6 promoter from W05B2.8Available sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGuide-P1-O1a (EL702)
Plasmid#140040PurposeCRISPR DuMPLING negative control plasmid with probe/barcode P1 and negative control lacO1array spacer in the sgRNA. Also template for library PCRs.DepositorInsertbarcode P1 and sgRNA lacO1 array
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(NT:NT)
Plasmid#138260PurposeExpression of a non-targeting sgRNA to the left and right of iCas9 recognition site to be used as a control in Traffic Light reporter systemDepositorInsertNontargeting sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgPYM1
Plasmid#105249Purposehuman PYM1 sgRNADepositorInsertsgRNA for PYM1
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgX-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209060PurposeEntry cloning vector to insert an sgRNA of interest (using Esp3i digestion) into a vector that already contains sgRNAs against mouse Rb1, Trp53, and Rbl2 and CMV Cre recombinase.DepositorInsertsgRNAs targeting Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionTagsExpressionMutationPromoterU6Available sinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_045
Plasmid#107144Purposecloning of a sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro
Plasmid#52963PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and puromycin resistance from EF-1a promoter. 3rd generation lentiviral backbone.DepositorHas ServiceCloning Grade DNAInsertsS. pyogenes sgRNA cassette
Puromycin resistance
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEf1-a and hU6Available sinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-H2BC11
Plasmid#207755PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of H2BC11 for knock-in.DepositorInsertsgRNA Targeting C-terminus of H2BC11 (H2BC11 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRi_Mxi1_yl
Plasmid#91248PurposeCRISPR-dCas9-Mxi1 vector for Yarrowia lipolytica, expressing dCas9-Mxi1 and AvrII site for sgRNA insertionDepositorInsertsCodon optimized dCas9-Mxi1
sgRNA expression cassette
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterSCR1'-tRNA and UAS1B8-TEF(136)Available sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-EN1201
Plasmid#92144PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse TIGRE acceptor locusDepositorInsertspCas9-nuclease and sgRNA against mouse TIGRE acceptor locus
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9.EF1a-BFP.sgLMNA
Plasmid#98971PurposeCas9 Homologous Recombination Reporter. SpCas9 and a sgRNA targeting LMNA. TagBFP.DepositorInsertLMNA sgRNA and spCas9
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
LRCherry2.1
Plasmid#108099PurposeLentiviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoter for sgRNA expression and EFS promoter…Available sinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aalb_743
Plasmid#176676PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029743) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprTagsExpressionInsectMutationPromoterAvailable sinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1
Plasmid#108098PurposeLentiviral expression plasmid of sgRNA with GFPDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoter for sgRNA expression and EFS promoter…Available sinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-HF-tetra-com-vector
Plasmid#132555PurposeVector plasmid expressing high fidelity spCas9 (R691A) and sgRNA scaffold with com replacing the Tetraloop.DepositorInsertsHigh fidelity Cas9
sgRNA scaffold with com replacing the Tetraloop
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PXN
Plasmid#227315PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PXN for knock-in.DepositorInsertsgRNA Targeting C-terminus of PXN (PXN Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAT003
Plasmid#171628Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA targeting TRAC and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-TRAC
mNeon
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterCAG and EF1-aAvailable sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgLenti
Plasmid#105996Purposesingle sgRNA expression vectorDepositorTypeEmpty backboneUseCRISPR and Lentiviral; S.pyogenes sgrna expressio…TagsExpressionMammalianMutationPromoterU6Available sinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAT009
Plasmid#171635PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting B2M and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-B2M
mTagBFP2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterCAG and U6Available sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-Blast
Plasmid#159741PurposeExpresses Cas9-2A-Blast and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorInsertdonor plasmid targeting sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT448
Plasmid#139388PurposeBile Acid inducible sgRNA-1 with PM1 driving Nanoluc expression (NOT Gate 1), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-1 with PM1 driving Nanoluc expression (NOT Gate 1),
UseSynthetic BiologyTagsExpressionMutationPromoterBile Acid inducible PromoterAvailable sinceJan. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT450
Plasmid#139390PurposeBile Acid inducible sgRNA-3 with PM3 driving Nanoluc expression (NOT Gate 3), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-3 with PM3 driving Nanoluc expression (NOT Gate 3), pNBU1 backbone, AmpR, ErmR
UseSynthetic BiologyTagsExpressionMutationPromoterBile Acid inducible PromoterAvailable sinceJan. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT492
Plasmid#139397PurposeBile Acid inducible sgRNA-5 with PM5 driving Nanoluc expression (NOT Gate 5), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-5 with PM5 driving Nanoluc expression (NOT Gate 5)
UseSynthetic BiologyTagsExpressionMutationPromoterBile Acid inducible PromoterAvailable sinceJan. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT493
Plasmid#139398PurposeBile Acid inducible sgRNA-6 with PM6 driving Nanoluc expression (NOT Gate 6), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-6 with PM6 driving Nanoluc expression (NOT Gate 6)
UseSynthetic BiologyTagsExpressionMutationPromoterBile Acid inducible PromoterAvailable sinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT494
Plasmid#139399PurposeBile Acid inducible sgRNA-7 with PM7 driving Nanoluc expression (NOT Gate 7), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-7 with PM7 driving Nanoluc expression (NOT Gate 7)
UseSynthetic BiologyTagsExpressionMutationPromoterBile Acid inducible PromoterAvailable sinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT449
Plasmid#139389PurposeBile Acid inducible sgRNA-2 with PM2 driving Nanoluc expression (NOT Gate 2), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-2 with PM2 driving Nanoluc expression (NOT Gate 2)
UseSynthetic BiologyTagsExpressionMutationPromoterBile Acid inducible PromoterAvailable sinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT451
Plasmid#139391PurposeBile Acid inducible sgRNA-4 with PM4 driving Nanoluc expression (NOT Gate 4), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-4 with PM4 driving Nanoluc expression (NOT Gate 4)
UseSynthetic BiologyTagsExpressionMutationPromoterBA inducible promotersAvailable sinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT455
Plasmid#139392PurposeaTC and Bile Acid inducible sgRNA-4 with PM4 driving Nanoluc expression (NOR Gate), AmpR, ErmRDepositorInsertaTC and Bile Acid inducible sgRNA-4 with PM4 driving Nanoluc expression (NOR Gate)
UseSynthetic BiologyTagsExpressionMutationPromoteraTC and BA inducible promotersAvailable sinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-EN479
Plasmid#86234PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse Rosa26 locusDepositorInsertspCas9-nickase and sgRNA against mouse rosa26 locus
UseMouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1_Puro
Plasmid#125594PurposeLentiviral expression of sgRNA with GFP and puromycin resistance geneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoter for sgRNA expression and EFS promoter…Available sinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-mB2M
Plasmid#154091PurposeSelf-Cutting and Integrating CRISPR backbone targeting murine B2MDepositorInsertsgRNA and BAIT targeting murine B2M locus
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only