We narrowed to 1,628 results for: sgrna vector
-
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRGEB31
Plasmid#51295PurposeBinary vector derived from pRGE31. Deliver sgRNA and Cas9 into plants by agrobacterium mediated transformation.DepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRice snoRNA U3 and dual 35S promoterAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-CRISPR
Plasmid#85402PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes with constitutive Cas9 expressionDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-XsgRNA-ccdB-EF1a-Puromycin
Plasmid#115519PurposeTo construct multiple sgRNA expression vector for CRISPRDepositorInsertccdB-sgRNA scaffold
UseCRISPRAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno EA
Plasmid#64071PurposeAdenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4DepositorInsertU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
UseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmBI
Plasmid#126028PurposePiggyBac cargo vector expressing rtTA, contains BsmBI sites for sgRNA cloningDepositorTypeEmpty backboneUseCRISPR; PiggybacExpressionMammalianPromoterU6Available SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROP-sgRNA-MS2
Plasmid#153457PurposeCROP-seq vector with mCherry and x2 MS2 loops in gRNA scaffoldDepositorInsertsgRNA empty backbone
UseCRISPRExpressionMammalianAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRi_Mxi1_yl_NHEJ
Plasmid#91249PurposeCRISPRi vector for Yarrowia lipolytica, repressing KU70 and KU80 for enhanced HRDepositorInsertsCodon optimized dCas9-Mxi1
KU70 sgRNA expression cassette
KU80a sgRNA expression cassette
KU80b sgRNA expression cassette
UseCRISPR and Synthetic BiologyExpressionYeastPromoterSCR1'-tRNA and UAS1B8-TEF(136)Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB700
Plasmid#64046PurposeLentiviral vector for expressing U6 sgRNA and CAGGS Cerulean fluorescent proteinDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterU6, CAGGSAvailable SinceMay 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSECC
Plasmid#60820Purpose3rd generation vector. Expresses a sgRNA of interest, Cas9 and CreDepositorInsertsCas9
Cre
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingTagsFlagExpressionMammalianMutationBsmBI site eliminated by C->A; E308GPromoterEFS and EFS (after Cas9-2A)Available SinceNov. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pICSL01009::AtU6p
Plasmid#46968PurposeEncodes the Arabidopsis U6 promoter in a level 0 vector (Weber et al. PLoS One 6:e16765, 2011). It is used to place an sgRNA uder the Arabidopsis U6 promoter.DepositorInsertAtU6p
UseCRISPRExpressionPlantAvailable SinceAug. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
Plasmid#64219PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2ADepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E1BExpressionMammalianPromoterCBh and U6Available SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cas9/pTREX-n
Plasmid#68708PurposeExpresses the fusion gene CAS9-HA-2xNLS-GFP in the pTREX-n backbone. This vector is used for cloning a specific sgRNA by BamHI, to be co-expressed with Cas9 for genome editing in Trypanosoma cruzi.DepositorInsertFusion gene Cas9-HA-2xNLS-GFP from vector pMJ920 (Addgene) .
UseCRISPRTagsFusion gene Cas9-HA-2xNLS-GFP from vector pMJ920 …MutationC4239T mutation that eliminates a BamHI restricti…Available SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEn-Chimera
Plasmid#61432PurposeGateway-Entry vector containing AtU6-26 promoter and sgRNA backboneDepositorInsertAtU6-26:sgRNA
UseCRISPRExpressionPlantPromoterAtU6-26Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Venus (EDCPV)
Plasmid#90085PurposeThis plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianPromoterEFSAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgGFP-NT1
Plasmid#46914PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1)DepositorInsertsgGFP-NT1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
Lenti-entry-puro
Plasmid#85745PurposeLentiviral vector for generating multiple sgRNAs carrying plasmids by Golden Gate Assembly.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57kan-T7-gRNA-U6 V2
Plasmid#115520PurposeTo construct multiple sgRNA expression vector for CRISPRDepositorInsertsgRNA scaffolf-U6 promoter
UseCRISPRAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-sgRNA-com-BoxB-vector
Plasmid#132556PurposeExpresses dCas9-DMNT3a-DMNT3l fusion protein, lambda N22-KRAB fusion protein, and sgRNA scaffold with com and BoxB replacing the Tetraloop and the loop 2 respectively.DepositorInsertsdCas9-DMNT3a-DMNT3l (DNMT3A Synthetic)
Lambda N22-KRAB
sgRNA acaffold with com and BoxB replacing the Tetraloop and the loop 2.
ExpressionMammalianAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDT-sgRNA
Plasmid#138271PurposeDual-targeting sgRNA vector that contains both a sgRNA against BFP (sgBG) and a sgRNA for a genomic target site (sgTS)DepositorInsertsgBG, sgTS
UseCRISPRExpressionMammalianAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only