We narrowed to 9,209 results for: sgRNA
-
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEJS614_pTetR-P2A-BFPnls/sgNS
Plasmid#108650PurposeNon-specific Spy sgRNA under U6 promoterDepositorInsertsNon-specific sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable sinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDonor_hU6
Plasmid#69312PurposesgRNA scaffold and human U6 promoterDepositorInserthU6 promoter and sgRNA scaffold flanked by BbsI sites
UseCRISPRPromoterhuman U6 promoterAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6a:sgRNA#1
Plasmid#64245Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTol2-hsp70l:Cas9-t2A-GFP, 5xU6:sgRNA
Plasmid#108871PurposeExpression of heat shock inducible Cas9-GFP and U6-driven 5 individual gRNAs for scGESTALT in zebrafishDepositorInserts5xU6:sgRNA
Cas9-t2A-GFP
UseCRISPRPromoterU6 and hsp70Available sinceApril 25, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6b:sgRNA#3
Plasmid#64247Purposeexpresses sgRNA under U6b promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-EN479
Plasmid#86234PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse Rosa26 locusDepositorInsertspCas9-nickase and sgRNA against mouse rosa26 locus
UseMouse TargetingExpressionMammalianAvailable sinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6a:sgRNA#2
Plasmid#64246Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6c:sgRNA#4
Plasmid#64248Purposeexpresses sgRNA under U6c promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
Plasmid#83306PurposeLentivirus vector to express guideRNA and dCas9 with puro resistant geneDepositorInsertsgRNA and dCas9 from pX330
UseLentiviralTagsFLAG and PA tagsExpressionMammalianPromoterU6 for sgRNA and CBh for dCas9Available sinceDec. 13, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJMP3
Plasmid#79875PurposeBacillus subtilis sgRNA expression vector; integrates into thrCDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable sinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6d:sgRNA#5
Plasmid#64249Purposeexpresses sgRNA under U6d promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC43
Plasmid#66565PurposesgRNA + 2XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 2XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLQ9834_sglacZ: pHR-hU6-CasMINI sgRNA_#2 (sgLacZ); EF1a-Puro-T2A-BFP- WPRE
Plasmid#176272PurposeExpression of non-targeting sgRNA of CasMINIDepositorInsertCasMINI non-targeting sgRNA (sgLacZ) and BFP
UseLentiviralExpressionMammalianPromoterU6Available sinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.GFP
Plasmid#57818PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGPromoterEFS and hU6Available sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1-puro U6 sgRNA BfuAI large stuffer
Plasmid#52628Purposelentiviral U6 driven sgRNA cloning vector where guide sequences are inserted between BfuAI sites, improved cassette cloning efficiencyDepositorInsertKanamycin cassette
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceApril 25, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9(BB)-2A-Neo
Plasmid#127762PurposeUsed for expression of sgRNA in mammalian cellsDepositorTypeEmpty backboneExpressionMammalianAvailable sinceJune 24, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9(BB)-2A-Hygro
Plasmid#127763PurposeUsed for expression of sgRNA in mammalian cellsDepositorTypeEmpty backboneExpressionMammalianAvailable sinceJune 24, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBluescriptSKII+ U6-sgRNA(F+E) empty
Plasmid#74707PurposeEncodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and BbsI sites that allow insertion of a spacer sequenceDepositorInsertU6 promoter driving sgRNA with Bbsi sites for insertion of spacer sequence
ExpressionMammalianAvailable sinceJuly 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by