Skip to main content

We narrowed to 13,453 results for: Mpl;

Showing: 3751 - 3800 of 13453 results
  1. pX459-sgAAVS1

    Plasmid
    #184403
    Purpose
    pX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGAT
    Depositor
    Insert
    AAVS1-specific sgRNA
    Use
    CRISPR
    Expression
    Mammalian
    Promoter
    U6 promoter
    Available Since
    May 20, 2022
    Availability
    Academic Institutions and Nonprofits only
  2. pMZ374

    Plasmid
    #59896
    Purpose
    Combination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: Empty sgRNA target (CspCI placeholder) (see comments).
    Depositor
    Inserts
    Cas9
    rrk1:sgRNA
    Use
    CRISPR
    Expression
    Yeast
    Mutation
    Silent muation of the CspCI site
    Promoter
    adh1 and rrk1
    Available Since
    Oct. 29, 2014
    Availability
    Academic Institutions and Nonprofits only
  3. pGADT7-αC

    Plasmid
    #197650
    Purpose
    Expression of GAL4 transcriptional activation domain (AD)-AP-2 αC fusion protein in yeast (yeast two-hybrid or yeast three-hybrid assays)
    Depositor
    Insert
    AP-2 αC
    Tags
    GAL4 transcriptional activation domain (AD) fragm…
    Expression
    Yeast
    Mutation
    Ser677T substitution
    Promoter
    ADH1
    Available Since
    March 28, 2023
    Availability
    Academic Institutions and Nonprofits only
Showing: 3751 - 3800 of 13453 results