171,702 results
-
Plasmid#168219PurposeMammalian expression of heat shock 70 kDa protein 8 fused to a C-terminal HA tagDepositorInsertHspa8
TagsHAExpressionMammalianPromoterCMVAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc3-CUL1
Plasmid#19896DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
XLone-Cas9-2A-GFP
Plasmid#170159PurposeExpress Cas9 and GFP upon doxycycline treatmentDepositorInsertCas9
UseSynthetic Biology; PiggybacTagsGFPExpressionMammalianPromoterTRE3G promoterAvailable SinceJuly 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
Antibody#213659-rAbPurposeAnti-Integrin αVβ5 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; binds the particular alpha/beta chain pair, blocks ligand binding/function (RGD-mimetic)DepositorRecommended ApplicationsFlow CytometryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMarch 27, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
LM627
Plasmid#191551PurposeLM627_MSG-AGGA-promoter-ccdb-TTCC-SNAC-hisDepositorInsertccdb
TagsSNAC-tag, HIS-tagExpressionBacterialAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
LgBiT-ST
Plasmid#207633PurposeA plasmid encoding LgBiT fused to SpyTagDepositorInsertLgBiT-SpyTag
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCE-hUL
Plasmid#41855PurposeNon-integrating (episomal) expression of human L-MYC and LIN28DepositorAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
TFORF0389
Plasmid#141600PurposeLentiviral vector for overexpressing the SMARCA4 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV9)
Viral Prep#83899-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable SinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCE-hSK
Plasmid#41814PurposeNon-integrating (episomal) expression of human SOX2 and KLF4DepositorAvailable SinceFeb. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pOpen-K12polLF (exo-)
Plasmid#165522PurposeDNA pol fragment used in flourescent labelling for microarray, dA and dT tailing, and ligating DNA adapters to DNA fragments.DepositorInsertDNA Polymerase I, Large (Klenow) Fragment (3'-5' exo-)
UseSynthetic BiologyAvailable SinceDec. 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
HA-HIF1alpha-wt-pBabe-puro
Plasmid#19365DepositorInsertHypoxia inducible factor 1 alpha (HIF1A Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationwt human cDNAAvailable SinceApril 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
mTq2-Calmodulin
Plasmid#198200PurposeFRET donor: Calmodulin-2 tagged with N-terminal mTurquoise2DepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TA1-DuET
Plasmid#213382PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-CuO-V5 CASC3 siRes1+2 f.l. WT
Plasmid#158540PurposeFor PiggyBac-mediated integration of V5-tagged siRNA-resistant full-length CASC3DepositorAvailable SinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
1136- Desmoplakin-GFP
Plasmid#32227DepositorAvailable SinceNov. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
Antibody#213653-rAbPurposeAnti-Integrin αVβ8 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; binds the particular alpha/beta chain pair, does not block functionDepositorRecommended ApplicationsFlow CytometryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMarch 27, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pDD427
Plasmid#202080PurposeFrame +2/-1 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame +2/-1 sgRNA
UseCRISPRPromoterEF1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Antibody#213657-rAbPurposeAnti-Integrin αVβ6 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; binds the particular alpha/beta chain pair, blocks ligand binding/function (RGD-mimetic)DepositorRecommended ApplicationsFlow CytometryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMarch 27, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pLX301
Plasmid#25895Purpose3rd generation lentiviral Gateway destination vector. Puromycin selection.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Gateway destination vectorExpressionMammalianAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCCl-MCS_miniCMV_EGFP
Plasmid#134984PurposeThe plasmid includes a EGFP gene driven by a minimal CMV promoter. Cis-regulatory elements can be cloned into the single EcoRV site. This plasmid can be used for generating a lentiviral vectorDepositorInsertEGFP
UseLentiviralPromoterminCMVAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-flex-iGABASnFR2-WPRE (AAV1)
Viral Prep#218877-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-flex-iGABASnFR2-WPRE (#218877). In addition to the viral particles, you will also receive purified pGP-AAV-syn-flex-iGABASnFR2-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of the improved GABA sensor iGABASnFR2 (positive change in fluorescence). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINKv1-pCALM1-Cre-3'-SYNGAP1-FLAG
Plasmid#244265Purpose3' AAVLINK plasmid for SYNGAP1 expressionDepositorAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
7xSMAD_RE::FLuc
Plasmid#124531PurposeSMAD2 FLuc luciferase reporterDepositorInsertSMAD FLuc reporter
UseLuciferase and Synthetic BiologyExpressionMammalianAvailable SinceJune 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
HA-CHMP4B
Plasmid#139013PurposeExpresses HA-tagged human CHMP4B in mammalian cellsDepositorInserthuman CHMP4B
TagsHAExpressionMammalianAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PuroR-2A-MLH1-SB
Plasmid#228871PurposePlasmid for MLH1-SB overexpressionDepositorInsertPuroR-2A-MLH1-SB
UseCRISPRAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hChR2(H134R)-mCherry (AAV8)
Viral Prep#26976-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-hSyn-hChR2(H134R)-mCherry (#26976). In addition to the viral particles, you will also receive purified pAAV-hSyn-hChR2(H134R)-mCherry plasmid DNA. Synapsin-driven, humanized channelrhodopsin H134R mutant, fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA
Plasmid#71409PurposeThere is no gene/insert. It is a backbone plasmid that others can use to insert sgRNAs of interest. The cloning site for this BsmBIDepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
scAAV-hIBA1a-GFP
Plasmid#214146PurposeSelf-complementary AAV vector packaging GFP under the human Iba1 promoterDepositorInsertGFP
UseAAVAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJR100
Plasmid#187240PurposeLentiviral sgRNA vector for Perturb-seq with mU6 sgRNA promoter, CR1 constant region with CS1 capture sequence in stem loop, and UCOE EF1alpha driving PURO-BFP marker expressionDepositorInsertLentiviral sgRNA vector for Perturb-seq with mU6 promoter
UseLentiviralAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKM446 (Flag-DAS+4))
Plasmid#108321PurposeOrbit integrating plasmid for C-terminal tagging with degradation tag DAS+4, using hygromycin as a selection marker.DepositorInsertattB-Flag-DAS+4
UseOrbit integrating plasmidAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
ER-mNeonGreen
Plasmid#137804PurposeVisualization of the Endoplasmic ReticulumDepositorInsertKDEL
ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLminP_Luc2P_RE10
Plasmid#90344PurposeIRF3 - Viral response gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterIRF3Available SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Antibody#213658-rAbPurposeAnti-Integrin αVβ6 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; binds the particular alpha/beta chain pair, blocks ligand binding/function (RGD-mimetic)DepositorRecommended ApplicationsFlow CytometryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMarch 27, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pYS19
Plasmid#202084PurposeFrame -2 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame –2 sgRNA
UseCRISPRPromoterEF1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRDB_345
Plasmid#231113PurposeABE activity-based selection cloning vectorDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMD18T-AtU6-HV5
Plasmid#239470PurposeEncodes a gRNA expression cassette driven by the AtU6 promoter.DepositorInsertU6-gRNA
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMD18T-AtU3b-HV5
Plasmid#239477PurposeEncodes a gRNA expression cassette driven by the AtU3b promoter.DepositorInsertU3b-gRNA
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMD18T-At7SL-HV5
Plasmid#239478PurposeEncodes a gRNA expression cassette driven by the At7SL promoter.DepositorInsert7SL-gRNA
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
p1300-dCas9-HV5
Plasmid#239479PurposeAn intermediate vector is used to assemble three gRNAs via Golden Gate cloning.DepositorInsertUBQ-dCAS9
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOpen-T5gene122
Plasmid#165544PurposePossesses two enzymatic activities: DNA synthesis (polymerase) and exonucleolytic activity that degrades ssDNA in the 3'-5' direction for proofreading purposes.DepositorInsertT5 DNA Polymerase
UseSynthetic BiologyAvailable SinceAug. 9, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
XBP-1 1: pFLAG.XBP1u.CMV2
Plasmid#21832DepositorAvailable SinceOct. 8, 2009AvailabilityAcademic Institutions and Nonprofits only -
RCAS GFP (CT#22)
Plasmid#13878DepositorInsertGFP
UseRetroviral; Avian expressionAvailable SinceFeb. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
HA-Rab11-WT
Plasmid#101047PurposeExpresses HA-tagged human Rab11-WT in mammalian cellsDepositorAvailable SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-EF1a-dCas9-VPR-eGFP
Plasmid#241307Purpose3rd generation lenti vector encoding dCas9 (s. Pyogenes) fused with the VP64-p65-Rta(VPR) and a 2A GFP fluorescence markerDepositorInserteGFP
UseLentiviralAvailable SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMito-mCherry-FRB_IRES_FKBP(I)-GBPen
Plasmid#128267PurposeBicistronic vector to express mitochondrial targeted mCherry-FRB (MitoTrap) as well as 1x FKBP-GBPenhancer (GFP Nanobody with 1 FKBP domain).DepositorInsertsMitoTrap
FKBP(I)-GBPen
ExpressionMammalianPromoterCMV and IRESAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-iCre
Plasmid#89573PurposeExpresses iCre under pCAGDepositorInsertiCre
UseCre/Lox and Synthetic BiologyTagsNLSExpressionMammalianAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMT3_SRSF1
Plasmid#201056PurposeExpress sumo-tagged human SRSF1DepositorAvailable SinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only