We narrowed to 5,579 results for: PEP
-
Plasmid#123217PurposeMammalian expression plasmid for Env from the 25711 HIV-1 isolate; C-terminal truncationDepositorInsertHIV-1 (25711) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOCC17
Plasmid#118875Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6 tag, cleavable with 3C, and C-terminal tagRFPDepositorInsertNcoI-HIS6-3C--NotI-ccdB-AscI-tagRFP-stop-HindIII cassette
TagsHIS6, cleavable with 3C protease and tagRFPExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOCC16
Plasmid#118870Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6 tag, cleavable with 3C, and C-terminal EGFPDepositorInsertNcoI-HIS6-3C--NotI-ccdB-AscI-EGFP-stop-HindIII cassette
TagsEGFP and HIS6, cleavable with 3C proteaseExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOCC218
Plasmid#118907Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS10, cleavable with 3C protease and N-terminal YBBR tagDepositorInsertNcoI-HIS10-3C-YBBR-NotI-ccdB-AscI-stop-HindIII cassette
TagsHIS10, cleavable with 3C protease, YBBR tagExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOCC18
Plasmid#118868Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6 tag, cleavable with 3C, and N-terminal tagRFPDepositorInsertNcoI-HIS6-3C-tagRFP-NotI-ccdB-AscI-stop-HindIII cassette
TagsHIS6, cleavable with 3C protease, tagRFPExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOCC171
Plasmid#118888Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6-MBP tag, cleavable with 3C, and N-terminal SNAP tagDepositorInsertNcoI-HIS6-MBP-3C-SNAP-NotI-ccdB-AscI-stop-HindIII cassette
TagsHIS6-MBP, cleavable with 3C protease; SNAP tagExpressionInsectPromoterpolHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOCC202
Plasmid#118880Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with C-terminal mKate2, and C-terminal HIS6 tag, cleavable with 3CDepositorInsertNcoI-NotI-ccdB-AscI-mKate2-3C-HIS6-stop-HindIII cassette
TagsmKate2, HIS6, cleavable with 3C proteaseExpressionInsectPromoterpolHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOCC139
Plasmid#118872Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6 tag, cleavable with 3C, and C-terminal monomeric GFPDepositorInsertNcoI-HIS6-3C--NotI-ccdB-AscI-mGFP-stop-HindIII cassette
TagsHIS6, cleavable with 3C protease and mGFPExpressionInsectPromoterpolHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ127B
Plasmid#99883PurposeExpress two TALE-VP64 activator linked by in-frame T2A (encoding Thosea asigna 'self-cleaving' 2A peptide) sequence under 2x35S promoterDepositorInsertTALE-VP64-T2A-TALE-VP64
UseTALENExpressionPlantAvailable SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYNL-C1_PTS1
Plasmid#65699PurposeExpresses YNL-PTS1 in mammalian cellsDepositorInsertperoxisomal targeting signal 1 (tripeptide SKL)
UseLuciferaseTagsYNLExpressionMammalianPromoterCMVAvailable SinceJuly 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCNL-C1_PTS1
Plasmid#65700PurposeExpresses CNL-PTS1 in mammalian cellsDepositorInsertperoxisomal targeting signal 1 (tripeptide SKL)
UseLuciferaseTagsCNLExpressionMammalianPromoterCMVAvailable SinceJune 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pONL-C1_PTS1
Plasmid#65701PurposeExpresses ONL-PTS1 in mammalian cellsDepositorInsertperoxisomal targeting signal 1 (tripeptide SKL)
UseLuciferaseTagsONLExpressionMammalianPromoterCMVAvailable SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-20b-T7-Ntx
Plasmid#58714PurposeExpresses T7-Notexin in Escherichia coliDepositorInsertNotexin
TagsT7 peptide tagExpressionBacterialPromoterT7Available SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET-Ce25
Plasmid#51296PurposeExpresses a plant arginyl-tRNA synthetase in E.coliDepositorInsertarginyl-tRNA synthetase
TagsHis Tag and ThioredoxinExpressionBacterialMutationGTT (Val) insertion after initiation codon to per…PromoterT7Available SinceJuly 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
PcDNA-DEST53-CypB-Del1 N-term GFP
Plasmid#36131DepositorInsertcyclophilin B (PPIB Human)
TagsGFPExpressionMammalianMutationcontains amino acids 37-216 of cyclophilin B; F21…PromoterCMVAvailable SinceNov. 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEG593
Plasmid#40119DepositorInsertMex-5 (ATG through 648 bp of 3'UTR) R274E K318E (RNAi res) (mex-5 Nematode)
UseGateway destination vectorTagsDendra2 PAFP (sequence optimized for worm express…ExpressionWormMutationR274E, K318E, Exon 2 recoded to be RNAi-resistantPromoter4.4 kb mex-5 promoter fragmentAvailable SinceOct. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEG628
Plasmid#40120DepositorInsertMex-5 (aa1-244) (RNAi resistant) (mex-5 Nematode)
UseGateway destination vectorTagsDendra2 PAFP (sequence optimized for worm express…ExpressionWormMutationcontains aa1-244, Exon 2 recoded to be RNAi-resis…Promoter4.4 kb mex-5 promoter fragmentAvailable SinceSept. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBS ADAMTS3
Plasmid#19205DepositorInsertADAM metallopeptidase with thrombospondin type 1 (ADAMTS3 Chicken)
ExpressionBacterialAvailable SinceSept. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAcUW51-CgE
Plasmid#13762DepositorInsertHSV-1 glycoprotein E
TagsHisExpressionInsectMutationC-terminal region of the HSV-1 gE (KOS strain ect…Available SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn NS34a-msGFP-'S-mito
Plasmid#158768PurposeLentiviral expression of self-cleaving membrane targeting peptide containing the OMP25 C-terminal targeting sequence, the P6P4 NS5A/5B cleavage site, msGFP and the NS3/4A protease.DepositorInsertNS3/4a protease and msGFP
UseLentiviralMutationFlexible linkers between the protease and msGFP a…AvailabilityAcademic Institutions and Nonprofits only -
AAV9retro
Plasmid#224687PurposeAAV packaging plasmid expressing Rep/Cap genesDepositorInsertRep2/Cap9retro
UseAAVMutationinsertion of 10-mer peptide from AAV2retro (LADQD…Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
anti-FLAG M2 heavy chain
Plasmid#175359PurposeMammalian expression vector for over-expression of anti-FLAG M2 heavy chain (C-terminal His8)DepositorInsertanti-FLAG M2 heavy chain
TagsHis8 tag and N-terminal secretion signal peptide …ExpressionMammalianMutationL51I (see paper)PromoterCMVAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTS117 His14-Avi-45xGS-anti GFP nanobody
Plasmid#199370PurposeBacterial expression plasmid for anti-GFP nanobody with an N-terminal His-tag and biotin acceptor peptide (Avi)DepositorInsertanti-GFP nanobody
Tags14xHis-AviExpressionBacterialMutationWTPromoterT5-LacOAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
SpyDock
Plasmid#124618PurposeExpresses SpyDock to bind SpyTag non-covalently for affinity purificationDepositorInsertSpyDock
TagsHis6ExpressionBacterialMutationE77A mutation prevents isopeptide bond formation,…PromoterT7Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
AIO-Puro
Plasmid#74630PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and Cas9-D10A nickase linked via 2A peptide with puromycin resistant marker to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRTagsPuromycin resistant markerExpressionMammalianPromoterCbhAvailable SinceMay 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEX-CMV-SP-YFP-STM2(15-746)
Plasmid#18862DepositorInsertStromal interaction molecule 2 (STIM2 Human)
TagsYFPExpressionMammalianMutationYFP inserted between signal peptide(SP) of STIM1 …Available SinceMarch 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
8522-M01-663
Plasmid#225660PurposeLentiviral expression of a cancer stem cell reporter that responds to presence of Sox2/Oct4 or their paralogs (green configuration)DepositorInsertdsCopGFP
UseLentiviralPromoterSORE6-mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLM-CMV-R-Cre
Plasmid#27546PurposeLentiviral bicistronic co-expression of Cre and mCherry; linked by a P2A peptide.DepositorInsertmCherry_P2A_Cre recombinase
UseCre/Lox and LentiviralPromoterCMVAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
MTNR1B-DuET
Plasmid#213349PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
OPRM1-DuET
Plasmid#213361PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 3xFlag IFIT3
Plasmid#53553Purposemammalian expression of IFIT3DepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
MTNR1A-DuET
Plasmid#213348PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCI-Caspase 1
Plasmid#41552DepositorInsertCaspase-1 (CASP1 Human)
TagsMycExpressionMammalianPromoterCMV immediate-early enhancer/promoterAvailable SinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-SV40 polyA signal
Plasmid#48627PurposeContributes a cassette containing an SV40 polyA signal as the 3’-module during MultiSite Gateway cloning of chimeric cDNAs, when a peptide module at the C-terminal end is not required.DepositorInsertSV40 early polyadenylation signal cassette
UseGateway entry vectorPromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACTA2_HL-P2A-eGFP-PGK-PuroR-ACTA2_HR
Plasmid#126705Purposedonor vector for targeting a 2A peptide followed by green fluorescent reporter to the human ACTA2 locus at the end of the endogenous coding sequenceDepositorInsertGFP
UseCRISPRAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)-Gx-SB
Plasmid#220125PurposeExpresses the 1.3-kDa Small BiT (SB) fragment of split NanoLuc, genetically fused via a semi-rigid peptide linker to a protein G adapter domain (Gx).DepositorInsertGx-SB
ExpressionBacterialAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)-Gx-LB
Plasmid#220126PurposeExpresses the 18-kDa Large BiT (LB) fragment of split NanoLuc, genetically fused via a semi-rigid peptide linker to a protein G adapter domain (Gx).DepositorInsertGx-LB
ExpressionBacterialAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
myristoylated ct-GRK2
Plasmid#178734PurposeN-myristoylation signaling peptide of Src and the C-terminal fragment of G-protein coupled receptor kinase 2 (ct-GRK2)DepositorInsertGRK2 (GRK2 Bovine)
UseLentiviralTagsSrc 1-15Mutationonly amino acids 548-671PromoterUbiquitinAvailable SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-B7
Plasmid#135509PurposeMammalian expression of myc-tagged HLA-B*07:02DepositorInsertHLA-B*07:02 (HLA-B Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D BARK p2A mCherry
Plasmid#117691PurposeGfaABC1D-iBARK-p2A-mCherry: Viral expression vector for astrocyte Gaq silencingDepositorInsertBARKrgs peptide
UseAAVTagsHA / FLAGAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWPI_SPbFGF
Plasmid#25812DepositorInsertpWPI_SPbFGF (FGF2 Human)
UseLentiviralMutationIg signal peptide in N-terminal of human FGF2Available SinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pmTurquoise2-T2A-Venus(L68V)
Plasmid#60494PurposeProduces equimolar levels of mTurquoise2 and mVenus(L68V). It can be used as a negative control for FRET.DepositorInsertmTurquoise2-T2A-mVenus(L68V)
TagsT2A peptideExpressionMammalianPromoterCMVAvailable SinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYPQ173
Plasmid#99907PurposeExpress CRISPR-Act2.0 system which contains pco-dCas9-VP64 fusion protein and MS2-VP64 fusion protein linked by in-frame T2A (encoding Thosea asigna 'self-cleaving' 2A peptide) sequenceDepositorInsertpco-dCas9-VP64-T2A-MS2-VP64
UseCRISPRExpressionPlantAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2
Plasmid#135504PurposeMammalian expression of myc-tagged HLA-A*02:01DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Tv9nL
Plasmid#188069PurposePROSS-designed high-redox potential laccase from Trametes versicolorDepositorInsertPROSS-designed high-redox potential laccase from Trametes versicolor
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation79 PROSS mutations, described in publicationAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE3G-MYCN
Plasmid#104542PurposePiggyBac vector encoding doxycycline-inducible human MYCNDepositorInsertMYCN proto-oncogene, bHLH transcription factor (MYCN Human)
ExpressionBacterial and MammalianPromoterTRE3GAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRbeta
Plasmid#136455PurposeMammalian expression plasmid for c-myc-tagged PDGFRBDepositorInsertPDGFRbeta (PDGFRB Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-HA-Flag-natT1R2
Plasmid#113944Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutininDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-839Available SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYCN_P2A_Hygro_Barcode
Plasmid#120463PurposeBarcoded lentiviral vector to express MYCN in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only