168,035 results
-
Plasmid#82719PurposeExpresses constitutively active human MKK6 and murine p38 alpha.DepositorExpressionBacterialMutationSer207 to Glu, Thr211 to GluAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pAAV/L7-6-GFP-WPRE
Plasmid#126462PurposeAn AAV vector that expresses GFP under the control of the L7-6 promoter. The L7-6 promoter is the short size (0.8-kb) and has highly specificity to Purkinje cells.DepositorInsertL7-6, Purkinje cell specific promoter
UseAAVExpressionMammalianAvailable SinceMay 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1
Plasmid#79873PurposeBacillus subtilis dCas9 expression vector; integrates into lacA/ganADepositorInsertdCas9
UseCRISPRExpressionBacterialMutationD10A, H840APromoterxylAAvailable SinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_K963_GFP_SNAP
Plasmid#159727PurposeExpresses kinesin-1 (amino acids 1-963) in Sf9 cells with a C-terminal GFP and SNAP tagDepositorInsertKIF5B (full length, 1-963 amino acids), K963 (KIF5B Human)
TagsGFP and SNAP tags and ZZ affinity tagExpressionInsectAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-Neo-ISG15
Plasmid#80404Purposeoverexpression of ISG15DepositorAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
plenti.CamKII.(synapto).iATPSnFR2.A95A.A119L.miRFP670nano3
Plasmid#209730PurposeExpresses presynaptic low affinity ratiometric ATP sensorDepositorInsert(synapto).iATPSnFR2.A95A.A119L.miRFP670nano3
UseLentiviralExpressionMammalianPromoterCamKIIAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP
Plasmid#235573PurposeDox-inducible expression of control superfolder (sf)GFP fused with scFVDepositorInsertsuperfolder (sf)fGFP
UseCRISPRAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT-HA-rM3D(Gs)
Plasmid#45549PurposeExpresses rM3D (Gs) neuronal activatorDepositorInsertrM3D (Gs)
TagsHAExpressionBacterial and MammalianPromoterCMVAvailable SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pY016 (pcDNA3.1-hLbCpf1)
Plasmid#69988PurposeExpresses humanized LbCpf1DepositorInserthLbCpf1
UseCRISPRTagsNLS-3xHAExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-mTOR
Plasmid#1861DepositorAvailable SinceJune 20, 2005AvailabilityAcademic Institutions and Nonprofits only -
pTET2-RlucCP-3MS2
Plasmid#198354PurposePart of Renilla reporter system, encodes Renilla luciferase with MS2 stem loops in the 3'UTRDepositorInsertRenilla Luciferase
UseLuciferaseExpressionMammalianPromoterpTET2Available SinceApril 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDest-565
Plasmid#11520PurposeGateway destination vector for bacterial expression; His,GST tagDepositorTypeEmpty backboneUseGateway destination vectorTags6xHis and GSTExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAT9651-BEAR-GFP
Plasmid#162989PurposeBEAR target plasmid with split EGFP and disrupted 5' splice siteDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Pur-CAG-mCherry
Plasmid#80946Purposehuman AAVS1 site targeting donor plasmid for knocking-in mCherry expression cassette driven by CAG promoterDepositorInsertmCherry
ExpressionMammalianPromoterCAG promoterAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1ab-Prkd1
Plasmid#139314PurposeDiacylglycerol biosensorDepositorAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-BN
Plasmid#60518PurposeSB-transposon with constitutive bi-directional promoter, one side: SfiI cloning site for GOI (contains filler DNA), other side: BFP and neomycin resistance geneDepositorTypeEmpty backboneUseTransposonExpressionMammalianPromoterEF1a/RPBSAAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_PflaB-msfGFPBb
Plasmid#118231PurposeGentamicin-resistant E.coli/B. burgdorferi shuttle vector; Encodes flagellin promoter driven msfGFPDepositorInsertflagellin promoter driven msfGFP
ExpressionBacterialAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
tetO.Nfia.Blast
Plasmid#117270PurposeExpresses Nfia and blasticidin resistance gene under control of tetO sequence.DepositorAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HA
Plasmid#235678PurposePlasmid control for pcDNA3.1-HA-RAD52-WT and pcDNA3.1-HA-RAD52-∆CDepositorTypeEmpty backboneExpressionMammalianAvailable SinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FAH-rtTA3G
Plasmid#120309PurposeAn AAV vector that expresses rtTA3G under the c-fos promoterDepositorInsertrtTA3G
UseAAVPromoterc-fosAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
CFTR-HiBiT Fusion Vector
Plasmid#236890PurposeExpress CFTR WT HiBiT in Mammalian Cells under a CMV promoterDepositorAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
TDP-REGv2(mScarlet-FLAG)#7 in pTwist-CMV backbone
Plasmid#216152PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. This plasmid has one of the best dynamic ranges of those tested (~100-fold) in SK-N-BE2 cells. It uses a cryptic exon. [Code 'A11'] Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with cryptic exon and C-terminal FLAG
ExpressionMammalianPromoterCMVAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28-hXRCC1
Plasmid#70759Purposebacterial expression of human XRCC1DepositorAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWRS3001_VCR1_WCR3
Plasmid#192206PurposeVCR1 and WCR3 tracrRNAs cloned into pTWIST AMP high copy backboneDepositorInsertVCR1-WCR3 tracrRNA
ExpressionMammalianAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTD-CTwinStrep
Plasmid#45939Purposeuse to create C-terminal Twin-Strep-tag fusion proteinsDepositorTypeEmpty backboneTagsTwin-StrepExpressionBacterialPromoterTrc (lactose/IPTG inducible)Available SinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Hygro EYFP H148Q/I152L
Plasmid#25874DepositorInsertEYFP H148Q/I152L
ExpressionMammalianMutationEYFP from pEYFP (Clontech) with H148Q and I152L m…Available SinceAug. 16, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA FLAG TORC2
Plasmid#22975DepositorAvailable SinceJan. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N LMP1
Plasmid#37962DepositorInsertLMP1 (LMP-1 H. Herpesvirus 4 (EBV))
UseRetroviralTagsFlag and HAExpressionMammalianPromoterPKGAvailable SinceAug. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-MKLP1
Plasmid#70145Purposemammalian expression of MKLP1 with an eGFP fusionDepositorAvailable SinceNov. 4, 2015AvailabilityAcademic Institutions and Nonprofits only