We narrowed to 60 results for: Crh
-
Plasmid#133773PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorUseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pSCrhaB2plus
Plasmid#164226PurposeBroad-range bacterial expression vector with modified rhamnose-inducible promoter. Harbours enhanced rhaS binding site and encodes T7 gene10 stem loop in mRNA for enhanced expression.DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterRhamnose-inducibleAvailable sinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCrhaB2
Plasmid#113634PurposeAn expression vector containing a rhamnose-inducible promoter to regulate gene expression in Burkholderia cenocepaciaDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterPrhaBAvailable sinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
EcRho
Plasmid#113121PurposeExpresses E. coli RhoDepositorInsertRho
UseTagsMGHExpressionBacterialMutationPromoterT7Available sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSCrhaB2_ApyOAHIDS
Plasmid#226246PurposeProduction of ApyA peptide modified by the B12-rSAM enzyme ApyD (optional, refer to publication), the cytochrome P450 enzyme ApyO, and the MNIO enzyme ApyHI, and the methyltransferase ApySDepositorInsertsHis6_ApyA
ApyD
ApyO
ApyH
ApyI
ApyS
UseTagsHexa-HistidineExpressionBacterialMutationPromoterAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCrhaB2_ApyOAHID
Plasmid#226245PurposeProduction of ApyA peptide modified by the B12-rSAM enzyme ApyD (optional, refer to publication), the cytochrome P450 enzyme ApyO, and the MNIO enzyme ApyHIDepositorInsertsHis6_ApyA
ApyD
ApyO
ApyH
ApyI
UseTagsHexa-HistidineExpressionBacterialMutationPromoterAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRHR1-DuET
Plasmid#213215PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCRHR1 (CRHR1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRHR2-DuET
Plasmid#213216PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCRHR2 (CRHR2 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRHR1-Tango
Plasmid#66256PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorInsertCRHR1 (CRHR1 Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
CRHR2-Tango
Plasmid#66257PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorInsertCRHR2 (CRHR2 Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRCIscript-crhr1_TAL1B
Plasmid#44235DepositorInsertcrhr1 pTAL scaffold 1B (crhr1 Zebrafish)
UseMrna transcription vectorTagsExpressionMutationPromoterT3Available sinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRCIscript-crhr1_TAL1A
Plasmid#44234DepositorInsertcrhr1 pTAL scaffold 1A (crhr1 Zebrafish)
UseMrna transcription vectorTagsExpressionMutationPromoterT3Available sinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRCIscript-crhr2_TAL1A
Plasmid#44236DepositorInsertcrhr2 pTAL scaffold 1A
UseMrna transcription vectorTagsExpressionMutationPromoterT3Available sinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRCIscript-crhr2_TAL1B
Plasmid#44237DepositorInsertcrhr2 pTAL scaffold 1B
UseMrna transcription vectorTagsExpressionMutationPromoterT3Available sinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSCrhaB2_ApyD_ RBS_ApyAOHIS
Plasmid#226247PurposeProduction of ApyA peptide modified by the B12-rSAM enzyme ApyD (optional, refer to publication), the cytochrome P450 enzyme ApyO, and the MNIO enzyme ApyHI, and the methyltransferase ApySDepositorInsertsHis6_ApyA
ApyD
ApyO
ApyH
ApyI
ApyS
UseTagsHexa-HistidineExpressionBacterialMutationPromoterAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shCrh1
Plasmid#132709PurposeEncodes short hairpin RNA (shRNA) #1 that targets the 3’-untranslated region of the rat Crh geneDepositorInsertshCrh(1) (Crh Rat)
UseLentiviralTagsExpressionMutationPromoterCMVAvailable sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shCrh2
Plasmid#132710PurposeEncodes short hairpin RNA (shRNA) #2 that targets the 3’-untranslated region of the rat Crh geneDepositorInsertshCrh(2) (Crh Rat)
UseLentiviralTagsExpressionMutationPromoterCMVAvailable sinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV8-hSyn-flex-miR30-eGFP-shCrh
Plasmid#132715PurposeEncodes Cre-dependent short hairpin RNA (shRNA) that targets the 3’-untranslated region of the rat Crh gene which encodes corticotropin releasing factorDepositorInsertGFP-shCrh (Crh Rat)
UseAAVTagsExpressionMutationPromoterSynapsin 1Available sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV-DIO-(mCherry-U6)-shRNA(anti-Crh)
Plasmid#214732PurposeExpresses shRNA against CRH, marked with mCherry, in infected and cre positive cellsDepositorInsertanti-Crh shRNA / mCherry
UseAAVTagsExpressionMutationPromoterAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMmaPylT_EF1_CRFR1-A95TAG-HA
Plasmid#174900Purposeamber suppression mediated CRFR1 A95TAG expression in mammalian cells; transient or piggy bac mediated integrationDepositorInsertCRFR1 (Crhr1 Rat)
UseTagsHAExpressionMammalianMutationA95TAGPromoterEF1Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A CRFR1 95TAG 263TAA-HA
Plasmid#154781Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and rat CRFR1 95TAG 263TAA, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertCRFR1 (Crhr1 Rat)
UseTagsHAExpressionMammalianMutation95TAG 263TAA in CRFR1-HA, hybrid PylT with A41AA …PromoterEF1Available sinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A CRFR1 95TAA 263TAG-HA
Plasmid#154780Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and rat CRFR1 95TAA 263TAG, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertCRFR1 (Crhr1 Rat)
UseTagsHAExpressionMammalianMutation95TAA 263TAG in CRFR1-HA, hybrid PylT with A41AA …PromoterEF1Available sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 shRNA against CRTC2
Plasmid#72711PurposeLentiviral expression of shRNA against CRTC2 (3rd generation)DepositorInsertCRTC2
UseLentiviralTagsCMV-EGFPExpressionMammalianMutationPromoterU6Available sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 shRNA against CRTC3
Plasmid#72712PurposeLentiviral expression of shRNA against CRTC3 (3rd generation)DepositorInsertCRTC3
UseLentiviralTagsCMV-EGFPExpressionMammalianMutationPromoterU6Available sinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 shRNA against CRTC1
Plasmid#72710PurposeLentiviral expression of shRNA against CRTC1 (3rd generation)DepositorInsertCRTC1
UseLentiviralTagsCMV-EGFPExpressionMammalianMutationPromoterU6Available sinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV CMV-DIO-(mCherry-U6)-shRNA(scrambled)
Plasmid#214733PurposeExpresses mCherry protein in infected and cre positive cellsDepositorInsertanti-Crh shRNA (scrambled) / mCherry
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS1153
Plasmid#29068PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle36 (CRH Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable sinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1156
Plasmid#29071PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorInsertPle39 (CRH Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable sinceJan. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1154
Plasmid#29069PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle37 (CRH Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable sinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1155
Plasmid#29070PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle38 (CRH Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable sinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pYSD002
Plasmid#212899PurposeEncodes S.cerevisiae CRH1 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertCRH1 (CRH1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZLrhaB2plus
Plasmid#211787PurposepSCrhaB2plus with modifications of resistance cassette to CmRDepositorInsertCmR
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCB2-sgRNA
Plasmid#129463PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).DepositorInsertpgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterBBa_J23119 (SpeI)Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSC201
Plasmid#129387PurposeA variant of the pSCrhaB2 vector with the oriR6K and mob genes from pGPΩ-TP. Used for homologous recombination of the rhamnose-inducible system into the chromosome of Burkholderia cenocepacia K56-2.DepositorInsertoriR6K and oriT
UseTagsExpressionBacterialMutationN/APromoterN/AAvailable sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBAD IFP1.4
Plasmid#91775PurposeBacterial expression of a fluorescent protein, Infrared Fluorescent Protein 1.4 + Heme oxygenase-1 (IFP1.4)DepositorInsertInfrared Fluorescent Protein 1.4 + Heme oxygenase-1
UseTagsHexa-Histidine tagExpressionBacterialMutationPromoteraraBADAvailable sinceJune 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDE735
Plasmid#103024Purposeexpression of a Cpf1 programming crRNA targetting CAN1, HIS4, PDR12 and ADE2 (crCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S)DepositorInsertcrCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S
UseCRISPRTagsExpressionYeastMutationPromoterSNR52Available sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorUseCRISPRTagsExpressionYeastMutationPromoterSNR52Available sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF0467
Plasmid#141619PurposeLentiviral vector for overexpressing the CARHSP1 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertCARHSP1 (CARHSP1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
SHKBP1A-c003
Plasmid#53636Purposebacterial expression plasmidDepositorInsertSHKBP1A
UseTagsHis-6-TEVExpressionBacterialMutationBacterial expression for structure determination;…PromoterT7Available sinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBAD24-sfGFPx2
Plasmid#51559PurposeSuperfolder GFP ORF cloned into pBAD24 for expression in E. coli. It contains additional aminoacids in the N and C terminus (polilinker sequences for cloning proteins in frame with GFP)DepositorInsertsuperfolder GFP
UseTagsGLESTCRHASLAVLADERRFSA and MARARAExpressionBacterialMutationContains additonal aa in the N and C terminus (in…PromoterAvailable sinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-guideless
Plasmid#129464PurposeDerived from pSCB2-sgRNA. 20 nucleotide binding sequence of sgRNA removed by inverse PCR. Used as a negative control.DepositorInsertGuideless gRNA backbone
UseCRISPRTagsExpressionBacterialMutationPromoterBBa_J23119 (SpeI)Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBAD24-rnc-sfGFP
Plasmid#51560PurposeGene encoding E. coli RNaseIII cloned as a N terminal translational fussion with superfolder GFP. Expression driven by arabinose (backbone is pBAD24).DepositorInsertrnc (rnc E. coli)
UseTagsGLESTCRHASLAVLADERRFSA and superfolder GFPExpressionBacterialMutationContains additonal aa at the end of the sfGFP in …PromoterAvailable sinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-non-target
Plasmid#129465PurposeDerived from pSCB2-sgRNA. 20 nucleotide sequence added as sgRNA binding region by inverse PCR. Used as a negative control.DepositorInsertNon-target/random gRNA
UseCRISPRTagsExpressionBacterialMutationPromoterBBa_J23119 (SpeI)Available sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
AAV8-hSyn-flex-miR30-eGFP-shDyn
Plasmid#132716PurposeEncodes Cre-dependent short hairpin RNA (shRNA) that targets the 3’-untranslated region of the rat Pdyn gene, which encodes dynorphinDepositorInsertGFP-shDyn (Pdyn Rat)
UseAAVTagsExpressionMutationPromoterSynapsin 1Available sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCRL5-COMP5AP-AviTag-9xHis
Plasmid#157554PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertFCRL5 (FCRL5 Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCRL3-COMP5AP-AviTag-9xHis
Plasmid#157477PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertFCRL3 (FCRL3 Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only