-
Plasmid#12560DepositorInsertCCAAT enhancer binding protein gamma (Cebpg Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
OR6K6_Deletion_gRNA3
Plasmid#195197Purposedual gRNAs for deletion of OR6K6 in a third generation Cas9 backbone with GFPDepositorInsertOR6K6 dual gRNA (OR6K6 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_Lb
Plasmid#155051PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-35kb-DSF
Plasmid#227490Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-35kb-DSF
Plasmid#227491Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-29kb-USF
Plasmid#227466Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 29kb Upstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-26kb-USF
Plasmid#227467Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 26kb Upstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-40kb-USF
Plasmid#227460Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 40kb Upstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-26kb-USP
Plasmid#227444Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 26kb Upstream Prdm8
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-11kb-USP
Plasmid#227447Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 11kb Upstream Prdm8
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbATML1-2pro and NbATML1-1pro
Plasmid#231154PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNAs targeting NbATML1-2pro and NbATML1-1proDepositorInsertTREX2 and mobile gRNAs targeting NbATML1-2pro and NbATML1-1pro
UseTagsExpressionPlantMutationPromoterPEBV sub-genomicAvailable sinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7854 pHR (hU6-crGLY-EFS-PuroR-WPRE)
Plasmid#214884PurposeLentiviral vector encoding RfxCas13d targeting GLY guide arrayDepositorInserthU6-crGLY-EFS-PuroR-WPRE
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-hcr5
Plasmid#193661PurposeExpression of tandem pre-sgRNA array hcr5 for LbCas12aDepositorInsertU6-DNMT3B-sgRNA-KLF4-sgRNA-TET1-sgRNA-PRR5L-sgRNA-CFTR-sgRNA-tRNA
UseTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_As
Plasmid#155055PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PAK7 gRNA (BRDN0001149524)
Plasmid#75715Purpose3rd generation lentiviral gRNA plasmid targeting human PAK7DepositorInsertPAK7 (PAK5 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAc-C Med12His
Plasmid#49240Purposeexpresses human Med12 with His tag in insect cellsDepositorInsertMed12 (MED12 Human)
UseTagsHisExpressionInsectMutationPromoterPolyhedrinAvailable sinceNov. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-EF1a-ChR2[H134R]-mCherry-Puro-WPRE
Plasmid#125256Purpose3rd gen lentiviral expression of humanized ChR2 with H134R mutation fused to mCherry driven by EF1a promoter for optogenetic activation with puro selectionDepositorInserthChR2(H134R)
UseLentiviralTagsmCherryExpressionMammalianMutationPromoterEF1a-forwardAvailable sinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-mCherry-p53 deltaN
Plasmid#49243Purposeexpresses human p53 deltaN and mCherry in mammalian cellsDepositorInsertp53 deltaN (TP53 Human)
UseTagsIRES-mCherryExpressionMammalianMutationdeltaN ( lacks 39 residues at the N-terminus)PromoterCMVAvailable sinceDec. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP-p53 tethered
Plasmid#49245Purposeexpresses two human WT p53s tethered together and also expresses EGFP in mammalian cellsDepositorInsertp53-p53 (TP53 Human)
UseTagsIRES-EGFPExpressionMammalianMutationPromoterCMVAvailable sinceDec. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shOCT4
Plasmid#198761Purposeconditional knockdown of OCT4DepositorInsertshOCT4 (POU5F1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-puro_Panc480-MT7
Plasmid#200941PurposeMultiplexed CRISPR array expressing 7 sgRNA in a lentiviral backboneDepositorInsertmultiplexed sgRNA array
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6, EF-1aAvailable sinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
LMPd Amt LDHA
Plasmid#209408PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertLdhA shRNA (Ldha Mouse)
UseRetroviralTagsExpressionMutationPromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pROS_phleo-Tps1/Gsy2
Plasmid#196612PurposeEncoding guide RNAs for the knock out of TPS1 and GSY2 genesDepositorUseTagsExpressionYeastMutationPromoterSNR52Available sinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_2
Plasmid#155066PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_2
Plasmid#155074PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_4
Plasmid#155072PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP-deltaNp53:WTp53
Plasmid#49244Purposeexpresses human p53 deltaN linked to full length p53 with C terminal His tag and also expresses EGFP in mammalian cellsDepositorInsertp53 deltaN and p53 WT (TP53 Human)
UseTagsHis and IRES-EGFPExpressionMammalianMutationPromoterCMVAvailable sinceDec. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC1A7
Plasmid#131998PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC1A7 (SLC1A7 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCHKOv3-CD46 Ex3_3-Lb
Plasmid#209029PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-As
Plasmid#209033PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…PromoterAvailable sinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP
Plasmid#102634PurposeIn vitro expression of sfGFP from the T7 promoterDepositorInsertsfGFP
UseTagsstrep tagExpressionBacterialMutationPromoterT7Available sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP082
Plasmid#103875PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces marxianusDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces marxianus
UseCRISPRTagsExpressionYeastMutationPromoterScTDH3Available sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJL1-mRFP1
Plasmid#102630PurposeIn vitro expression of mRFP1 from the T7 promoterDepositorInsertmRFP1
UseTagsExpressionBacterialMutationPromoterT7Available sinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJL1-mCherry
Plasmid#102629PurposeIn vitro expression of mCherry from the T7 promoterDepositorInsertmCherry
UseTagsExpressionBacterialMutationPromoterT7Available sinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1(-) mouse C/EBP delta
Plasmid#12559DepositorInsertCCAAT/Enhancer-binding Protein delta (Cebpd Mouse)
UseTagsExpressionMammalianMutationS2G introduced during cloningPromoterAvailable sinceJuly 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
pJL1-mOrange
Plasmid#102632PurposeIn vitro expression of mOrange from the T7 promoterDepositorInsertmOrange
UseTagsExpressionBacterialMutationPromoterT7Available sinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only