We narrowed to 10,106 results for: UTY
-
Plasmid#218129PurposeHybrid circuit displaying hsCRBN-W384A,Y386A bait (P22 anchor) and driving expression of luxABDepositorAvailable SinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only
-
AAV2_CAG_oROS-HT(C199S)_WPRE
Plasmid#216415PurposeEncodes the loss-of-function mutation C199S of genetically encoded, chemigenetic fluorescent peroxide sensor oROS-HT in AAV viral vectorsDepositorInsertoROS-HT(C199S)
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHES7-NLuc-2A-tdTomato
Plasmid#204348PurposeDonor vector to tag endogenous pig HES7 locusDepositorInsertNLuc-2A-tdTomato
TagsNanoLuc and tdTomatoExpressionMammalianAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28 mOct4-POU
Plasmid#206393PurposeExpresses the DNA binding domain of the Oct4 with a 6xHis tag for protein purificationDepositorAvailable SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-FHIP
Plasmid#198527PurposeExpression of GAL4 DNA-binding domain (BD)-FHIP fusion protein in yeast (yeast two-hybrid assays)DepositorInsertFHIP (FHIP1B Human)
TagsGAL4-DNA binding domain fragmentExpressionYeastMutationsilent mutations in codons 353 and 651 as well as…PromoterADH1Available SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
RAT +D122H
Plasmid#187426PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorExpressionInsectMutationchanged aspartic acid at 129 for histidinePromoterPH and p10Available SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
RAT +R111E
Plasmid#187425PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorExpressionInsectMutationchanged arginine at 118 to glutamic acidPromoterPH and p10Available SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
MSNA-c029
Plasmid#175471PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Contains L281R and H288A point mutations that reduce binding to CD44.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
ST-Tstem(5A)-GFP
Plasmid#162502PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. The mutated stem region of Tac is inserted within ST.DepositorTagsGFPExpressionMammalianMutationThe mutated Tac stem region is inserted within ST…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-STC(5A)
Plasmid#162491PurposeExpresses non-O-glycosylated partial length Tac (stem region, TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorInsertpartial length Tac (stem region with mutations, TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its stem region, TM…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR_P4-P1R:PER36modp
Plasmid#128431PurposeGateway (Invitrogen) promoter clone (pDONR_P4-P1R) with premature stop codons introduced within the Xero1 and Xero2 genes in the PER36 promoter entry clone (Kunieda et al. 2013).DepositorInsertPEROXISADE36 (AT3G50990 Mustard Weed)
UseGateway promoter entry cloneMutationPremature stop codons introduced into the Xero1 (…PromoterPEROXISADE36Available SinceOct. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKLV2-U6gRNA5(Apc-g1)-PGKpuroBFP-W
Plasmid#105022PurposeLentiviral gRNA plasmid targeting mouse Apc , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Hgs-g1)-PGKpuroBFP-W
Plasmid#105032PurposeLentiviral gRNA plasmid targeting mouse Hgs , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2delta
Plasmid#124154PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1alpha
Plasmid#124147PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1beta
Plasmid#124148PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1gamma
Plasmid#124149PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2alpha
Plasmid#124151PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2beta
Plasmid#124152PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2gamma
Plasmid#124153PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 (-) hYAP 1-1beta
Plasmid#124140PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_VPEVS
Plasmid#105863PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_ILGGP
Plasmid#105855PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH2charge
Plasmid#105852PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutations modify charge of CH2 domain.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1, muatations: Gl…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1538
Plasmid#82431PurposePlasmid for expression of NHA-tagged human-Nematostella GW182 11W11A chimera in mammalian cellsDepositorInserths-nvGW182 11W11A chimera
TagsNHAExpressionMammalianMutationaa 1-1169 of siRNA resistant hsTNRC6A (Q8NDV7-2) …PromoterCMVAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
Progerin-S22D-CS-pLPC
Plasmid#73810PurposeProgerin mutant where Serine 22 is mutated to aspartic acid and where there is a substitution of cysteine in CaaX-motif by a serineDepositorInsertProgerin (LMNA Human)
UseRetroviralExpressionMammalianMutationProgerin with substitution of cysteine in CaaX-mo…PromoterCMVAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPC-S22AProgerin-CS
Plasmid#69063Purposeencodes a Progerin mutant with serine 22 mutated to an alanine and with a substitution of cysteine in CaaX-motif by a serineDepositorInsertProgerin (LMNA Human)
UseRetroviralExpressionMammalianMutationProgerin with serine 22 mutated to alanine and wi…PromoterCMVAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
tdEos-EB3-7
Plasmid#57610PurposeLocalization: MT End Binding Protein, Excitation: 505 / 569, Emission: 516 / 581DepositorAvailable SinceJan. 16, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
DRH001_scAAV-hSyn-iCre-HA
Plasmid#225086PurposeExpression of iCre with an HA tag in neurons driven by human synapsin promoter.DepositorInsertiCre
UseAAV and Cre/LoxTagsHAExpressionMammalianPromoterhSynAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT4-U6-sgRNA-CMV-EGFP
Plasmid#239587PurposeSleeping-beauty based EV for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseSleeping beauty transposoneExpressionMammalianPromoterhU6Available SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
SB-CAG-mCherry-P2A-EIF3D-NN-IP
Plasmid#236771PurposeA sleeping beauty-based vector containing CAG promoter-driven mCherry-P2A-EIF3D S528N/S529N-IRES-Pac.DepositorInsertEIF3D (EIF3D Human)
UseSleeping beautyExpressionMammalianMutationchanged Serine 528 to Asparagine and Serine 529 t…PromoterCAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6b
Plasmid#207852PurposeMammalian expression of PE6b prime editorDepositorInsertPE6b
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationTf1rt(P70T, G72V, S87G, M102I, K106R, K118R, I128…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-His6-ERK2-MEK1_R4F_coexpression
Plasmid#39212DepositorTagsHis6 and RBSExpressionBacterialMutationMEK1(R4F) = S218E, S222D and deletion of AA32-51PromoterT7 and T7 via RBSAvailable SinceJuly 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4A
Plasmid#224448PurposeRep/Cap plasmid for the production of MyoAAV 4A, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYNSL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
A24M04 Ig kappa light chain-pFEEKW
Plasmid#234810PurposeExpress Ig kappa light chain containing the VL region of the monoclonal antibody, A24M04, specific for human papilloma virus16 L1DepositorUseLentiviralExpressionBacterial and MammalianPromoterEEK promoterAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV2A
Plasmid#224440PurposeRep/Cap plasmid for the production of MyoAAV 2A, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDQTTL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1304-AAV-EFSNC-dCjCas9-KRAB-MECP2
Plasmid#223149PurposeExpression of KRAB and truncated MECP2 with dCjCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKmCherry2AGFP-W
Plasmid#67982PurposeCas9 activity reporter with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPREAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W
Plasmid#67980PurposeCas9 activity reporter with BFP and GFP.DepositorInsertU6gRNA cassette, PGKBFP2AGFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSSRB274_pAC8-eGFP-hsCRBN
Plasmid#218791PurposeInsect cell expression vector for FLAG-TEV-eGFP-Prescission-hsCRBNDepositorInsertProtein cereblon (CRBN Human)
TagsFLAG-TEV-eGFP-PrescissionExpressionInsectMutationeGFP fused to N-terminusPromoterpolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (IRES-GFP)
Plasmid#85181PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interaction. Co-expresses EGFP for selectionDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Archon1-KGC-EGFP
Plasmid#108418PurposeAAV production plasmid encoding for Archon1 fluorescent voltage reporterDepositorInsertArchon1-KGC-EGFP
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only