We narrowed to 7,491 results for: RAP
-
Plasmid#216318PurposeSplit fluorophore assay to test reconstitution via mRNA trans-splicing (REVeRT system).DepositorInsertsplit cerulean fluorescent protein + splice donor site
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21a(+)-Bst LF-6xHis
Plasmid#159148Purposeexpresses His-tagged large fragment of Bst polymeraseDepositorInsertlarge fragment of Geobacillus stearothermophilus DNA polymerase I
TagsHisExpressionBacterialAvailable SinceSept. 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET28a-gp32-H6
Plasmid#163912PurposeExpresses T4 gp32 for bacterial expression and affinity purificationDepositorInsertgp32
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_haPD-1
Plasmid#226716PurposePlasmid enabling yeast-mediated expression and secretion of high affinity PD-1 microbody (haPD-1)DepositorInsertHigh affinity PD-1 microbody
TagsHA tag and Mating factor alpha secretion signalExpressionYeastPromoterpTEF1Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-N1-YAP
Plasmid#166457PurposeExpresses fusion of mEGFP and YAPDepositorInsertmEGFP, YAP (YAP1 Human)
ExpressionMammalianAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B G120A
Plasmid#123235PurposeExpresses mCherry-EGFP-LC3B G120A in mammalian cells. Negative control for tandem reporter. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a-uvsX-H6
Plasmid#163913PurposeExpresses uvsX for bacterial expression and affinity purificationDepositorInsertuvsX
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shSTING-Hsa
Plasmid#128158PurposeDoxycyclin inducible shRNA knockdown of human STING geneDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiMPH v2 (Neo)
Plasmid#92065PurposeModified version of lentiMPH v2, a lenti vector encoding the MS2-P65-HSF1 activator helper complex and neo resistance marker (EF1a-MS2-p65-HSF1-2A-Neo-WPRE).DepositorInsertMS2-P65-HSF1_2A_Neo (HSF1 Human, Synthetic)
UseLentiviralExpressionMammalianMutationN55K in MS2PromoterEF1aAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 1 tet pLKO puro
Plasmid#162985PurposeTet-inducible shRNA targeting human METTL3 #1DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 2 tet pLKO puro
Plasmid#162984PurposeTet-inducible shRNA targeting human METTL3 #2DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG CLTX-CAR
Plasmid#157743Purposeknock CLTX-CAR into AAVS1 safe harbor locus for constitutive expressionDepositorInsertchlorotoxin containing chimeric antigen receptor targeting glioblastoma
UseCRISPR, Synthetic Biology, and TALENExpressionMammalianPromoterCAGAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABE-hygro-2xMyc-Rac1-WT
Plasmid#128580PurposeFor mammalian cell expression of WT murine RAC1 carrying 2x Myc epitope tag sequences at the N-terminus.DepositorAvailable SinceAug. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRosa26-EF1a-hCas9IRESneo
Plasmid#67987PurposeMouse Rosa26 targeting vector carrying the EF1a-hCas9-IRES-neo cassetteDepositorInsertEF1a-hCas9IRESneopA
ExpressionMammalianAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hSNCA-NE
Plasmid#102361PurposeOverexpression of synuclein alpha in mammalian cellsDepositorAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG-CLTX CD32a-tm CD3z CAR
Plasmid#171963PurposeDonor plasmid for CLTX T-CAR expression in human cellsDepositorInsertSynthetic CLTX CD32a-tm CD3z CAR
UseCRISPR, Synthetic Biology, and TALENExpressionMammalianPromoterCAGAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgCTRL
Plasmid#209750PurposeLentiviral transfer plasmid to express Cas9 and a control, non-specific gRNA (does not target any human gene)DepositorInsertCas9
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRExpressionMammalianPromoterU6 and short human rhodopsin promoterAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXD024 - pLKO-EF1a-GFP-P2A-FLuc-WPRE
Plasmid#192204PurposeLenti-GL(GFP-Luciferase)DepositorInsertLenti-GL(GFP-Luciferase)
UseLentiviral; Mammalian expressionMutationNAAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW17
Plasmid#158207Purpose2lox landing pad plasmid with mariner transposon and transposase used for CRAGEDepositorInsertloxP/Cre/KmR/Lox5171/Mariner IR oriT/transposase
Available SinceDec. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIV-BRAFV600E-mOrange2
Plasmid#110732PurposeMammalian Expression of BRAFV600E IRES H2B-mOrange2DepositorInsertBRAFV600E IRES H2B-mOrange2 (BRAF Human)
UseLentiviralExpressionMammalianMutationBRAF V600EAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-AKAP95-FRB
Plasmid#138254PurposeFull-length AKAP95 fused to FRB (rapamycin-binding domain). Used in conjunction with pcDNA3-FKBP-ICUE3-NLS to monitor cAMP dynamics within AKAP95 nanodomain.DepositorInsertAKAP95-FRB (AKAP8 Human)
TagsFRB rapamycin binding domain and HA epitopeExpressionMammalianPromoterCMVAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1 TIM9,10
Plasmid#170280PurposeExpresses both yeast Tim9 and yeast Tim10 (the latter with cleavable N-ter His-tag), codon-optimized for E. coli productionDepositorInsertExpressionBacterialPromoterTim9: via NdeI/XhoI into the MCS2; Tim10: via Bam…Available SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FKBP12-Gag(HIV)
Plasmid#138476PurposeExpresses FKBP12 fused Gag for packaging FRB-SpCas9 into NanoMEDIC particle.DepositorInsertHIV Gag
TagsFRBP12 and Lynn Myristolation siteExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iFlpV
Plasmid#140137Purposecan be used to generate AAV virus that will express light-inducible site-specific iFlpV recombinaseDepositorHas ServiceAAV PHP.eB and AAV1InsertiFlpV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY098-RetroEFS-BCMABBz-WPRE
Plasmid#192199PurposeRetro-BCMACARDepositorAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-15b_LC3B
Plasmid#73949PurposeFor recombinant expression of human LC3B/MAP1LC3B in E. coliDepositorAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-membrane-mEGFP
Plasmid#105526PurposeT7 promotor drives in vitro mRNA transcription of a mEGFP-tagged membrane reporterDepositorInsertGNAI2 (GNAI2 Human)
UseIn vitro transcriptionTagsmEGFPMutationfragment encoding the plasma membrane targeting s…PromoterT7Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
OPEN Beta2-microglobulin
Plasmid#215657PurposeE. coli expression of human beta-2-microglobulin containing a cysteine mutation for disulfide linkage to mutant HLA.DepositorInsertOPEN Beta2-microglobulin (B2M Human)
ExpressionBacterialMutationHistidine 31 to CysteinePromoterT7Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-RGR(DMD#1)-AmCyan-A
Plasmid#138482PurposeExpresses sgRNA targeting human DMD (Dystrophin) for packaging into NanoMEDIC particle.DepositorInsertRibozyme-flanked gRNA and AmCyan
UseCRISPRExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-imp α
Plasmid#119718PurposeExpresses EGFP-tagged human importinα in mammalian cellsDepositorInsertimportinα (KPNA2 Human)
TagsEGFPExpressionMammalianMutationcontains amino acids 251-529PromoterCMVAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPMQAK1-Ptrc-[E*](104)-Cas9-B0015-lacZ-PnrsB-mazF-LVA
Plasmid#190790Purpose[E*](104) construct. Theophylline inducible Cas9 (S. pyogenes) expression. Two BsaI-sites allow for simultaneous insertion of sgRNA and donor DNA. Includes a nickel-inducible curing system.DepositorInsertsCas9
mazF-LVA
UseCRISPR and Synthetic BiologyTagsLVAExpressionBacterialMutationsilent mutations of BpiI-sites in original Cas9 g…PromoterPnrsB and Ptrc-[E*](104)Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-N1-YAPS127A
Plasmid#166458PurposeExpresses fusion of mEGFP and YAPS127ADepositorInsertmEGFP, YAPS127A (YAP1 Human)
ExpressionMammalianAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
YFP-FKBP (YF)
Plasmid#20175DepositorInsertYFP-FKBP (YF): (FKBP1A Human)
ExpressionMammalianMutationFKBP was taken out from pC4M-F2E with a flanking …Available SinceMarch 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
Pet22b-YAP
Plasmid#166443PurposeBacterial expression of 6x His tagged YAPDepositorInsertYAP (YAP1 Human)
ExpressionBacterialAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro GFP-LC3B G120
Plasmid#123241PurposeExpression vector with PGK promoter for low expression of EGFP-LC3B G120. For lentivirus production and stable transduction in mammalian cells.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
UseLentiviralTagsEGFPExpressionMammalianMutationDeleted amino acids 121-125. Stop codon after G12…PromoterPGKAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1596 - pAAV SYN1 HA-hM3D(Gq)
Plasmid#121539PurposeAn adeno-associated viral vector expressing HA-tagged stimulatory DREADD (hM3D(Gq)) from a synapsin promoterDepositorHas ServiceAAV Retrograde, AAV2, and AAV5InsertHA-tagged hM3D(Gq) (CHRM3 Human)
UseAAVTagsHAExpressionMammalianPromoterSYN1Available SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStreptagIIx2 Alfatag 3C InsR EABR
Plasmid#234996PurposeFor production of Extracellular Vesicles (EVs), with the Insulin Receptor Strep-tag II labeled on their surfaceDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFAST-BAC BAF155/SMARCC1-His
Plasmid#177863PurposeTransfer vector to generate recombinant baculovirus expressing BAF155/SMARCC1-HisDepositorInsertSMARCC1 (SMARCC1 Human)
TagsHis and His tag at C-terminus with GGGGS linkerExpressionInsectPromoterpolyhedrinAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-TEAD4-IDR
Plasmid#166451PurposeExpresses fusion of mCherry and TEAD4-IDRDepositorInsertmCherry, TEAD4-IDR(89-230) (TEAD4 Human)
ExpressionMammalianAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
hTph2p-Luc
Plasmid#223526PurposeFirefly-luciferase reporter expression driven by human Tph2 promoterDepositorInsertTph2 promoter (TPH2 Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromoterhTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXD023 - pLKO-EF1a-Puro-P2A-FLuc-WPRE
Plasmid#192203PurposeLenti-PL(Puro-Luciferase)DepositorInsertLenti-PL(Puro-Luciferase)
UseLentiviral; Mammalian expressionMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PPO-mScarlet
Plasmid#139503PurposeExpresses mScarlet-tagged parapinopsin in mammalian cells for photoswitchable control of inhibitory GPCR signaling cascades.DepositorInsertparapinopsin
TagsmScarlet following Gly-Gly-Ser linkerExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCR4_miniFXN_8
Plasmid#234361PurposeMini FXN plasmid with a partial deletion of the 5' UTR and a large deletion of intron 1 in FXN. Does not contain GAA repeats.DepositorInsertFXN (FXN Human)
UseCloningTagsFlag TagMutationThere is a partial deletion in the 5'UTR of …Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRC54-DHX37-GFP
Plasmid#192149Purposeexpress DHX37-GFPDepositorAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHIV-INK4A-mOrange2
Plasmid#110730PurposeMammalian Expression of p16INK4A IRES H2B-mOrange2DepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-YAP shRNA2
Plasmid#166485PurposeHuman YAP RNAiDepositorInsertshRNA for human YAP (YAP1 Human)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-SLEV_NS2B-GS-NS3
Plasmid#203510PurposeExpresses SLEV NS2B-NS3 protease (with GS linker) from a GAL promoter with a URA3 markerDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only