We narrowed to 7,357 results for: Ank
-
Plasmid#184015PurposeMammalian Flag tagged expression clone for the mouse Prom1 splicing variant SV8 (GenBank accession BC028286). Deletion of exon 19a (amino acids 696-701), and deletion of amino acids 661 to 675.DepositorInsertProm1 SV8(-Ex19a) D-3 (Prom1 Mouse)
TagsFlagExpressionMammalianMutationDeletion of exon 19a (amino acids 696-701), and d…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Prom1 D+4
Plasmid#184023PurposeMammalian Flag tagged expression clone for the mouse Prom1 splicing variant SV8 (GenBank accession BC028286). Deletion of exon 19a (amino acids 696-701), and deletion of amino acids 731 to 745.DepositorInsertProm1 SV8(-Ex19a) D+4 (Prom1 Mouse)
TagsFlagExpressionMammalianMutationDeletion of exon 19a (amino acids 696-701), and d…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_095
Plasmid#180524PurposedCas9 KTK compatible plasmid. Contains dCas9 and lacZ dropout region with flanking D1.1 overhangs for insertion of gRNA expression assemblyDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB62 - pL0_STR (pro + 5U)
Plasmid#123186PurposeGolden Gate (MoClo; PRO + 5U) compatible STR1 promoter from Catharanthus roseusDepositorInsertCatharanthus roseus STR1 promoter and 5'UTR
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sitesAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_CASKIN1-1/1
Plasmid#91523PurposeProtein expression and purification of human SH3 domain construct CASKIN1-1/1DepositorInsertCASKIN1-1/1 (CASKIN1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_CASKIN2-1/1
Plasmid#91261PurposeProtein expression and purification of human SH3 domain construct CASKIN2-1/1DepositorInsertCASKIN2-1/1 (CASKIN2 Human)
ExpressionBacterialAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBABE-3xFLAG-NLS-TPP1-OB
Plasmid#79060PurposeRetroviral expression of 3xFLAG tagged, nuclear localized wild-type TPP1-OB folding domainDepositorInsertTPP1 (TPP1 Human)
UseRetroviralTags3xFLAG and NLSExpressionMammalianMutationWild-type TPP-OB folding domainPromoterCMVAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32A gRNA (BRDN0001146573)
Plasmid#76473Purpose3rd generation lentiviral gRNA plasmid targeting human STK32ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32A gRNA (BRDN0001145029)
Plasmid#76474Purpose3rd generation lentiviral gRNA plasmid targeting human STK32ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32A gRNA (BRDN0001145147)
Plasmid#76475Purpose3rd generation lentiviral gRNA plasmid targeting human STK32ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LV-indLS2
Plasmid#123068PurposeLentiviral construct that delivers a tamoxifen inducible Cre. Upon recombination, luc2 and mStrawberry express. Used to image spontaneous tumorigenesis or subclonal cell populations in vivo.DepositorInsertsCreERT2 with intron
Firefly luciferase
mStrawberry
UseLentiviral and Luciferase; FluorescenceExpressionMammalianMutationsynthetic intron added as indicatedPromoterCAGGS (after Cre mediated inversion) and CAGGS (f…Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-NNG-Slug-nCas9(D10A)-PolI5MΔ
Plasmid#249079PurposeExpresses nucleus-localized NNG-Slug-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertNNG-Slug-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphasS-RLuc8
Plasmid#140980PurposeEncodes a G alpha subunit (GNAS2) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphasS-RLuc8
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-TetOn-mCherry-OAZ1_FS-YFP
Plasmid#232356PurposeMammalian expression of dox-inducible polyamine sensor (polyamine levels = YFP/Cherry)DepositorInsertOAZ1 derived polyamine sensing module (OAZ1 Human)
UseLentiviralTagseYFP and mCherryExpressionMammalianPromoterTRE3GAvailable SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB953:PB-CAG-PuroR-nGFP-FLEx-mCherry-KASH-WPRE
Plasmid#168106PurposePiggyBac transposon vector constitutively driving PuroR-P2A-eGFP and Cre conditional expression of KASH nuclear membrane-bound mCherry. Conditional insert flanked by MCS for cloningDepositorInsertmCherry-KASH
UseCRISPR and Cre/LoxPromoterCAGAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-TOMM20
Plasmid#227307PurposeDonor template for mStayGold insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mStayGold Tag (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CENPA
Plasmid#227283PurposeDonor template for mStayGold insertion into the N-terminus of the CENPA locus. For centromere visualization. To be co-transfected with sgRNA plasmid px330-CENPA (Addgene #227282)DepositorInsertCENPA Homology Arms flanking a mStayGold Tag (CENPA Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
MARS
Plasmid#205232PurposeExpresses PLEKHA5 aa 143-271 (K163A and R164A) fused to mScarlet-i in mammalian cellsDepositorInsertPLEKHA5 aa 143-271 with K163A and R164A mutations (PLEKHA5 Human)
TagsNuclear Export Sequence and mScarlet-iExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Aquamarine-LC3B-TdLanYFP
Plasmid#228560PurposeEncodes the LC3B biosensor where LC3B is flanked by the Aquamarine/TdLanYFP donor/accpetor FRET pair and under the control of the CMV promoterDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Aquamarine-LC3B G120A-TdLanYFP
Plasmid#228561PurposeEncodes an uncleavable version of the LC3B biosensor. Mutated LC3B is flanked by the Aquamarine/TdLanYFP donor/accpetor FRET pair and under the control of the CMV promoterDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-R26-FLEX-mStr
Plasmid#135619PurposeDonor vector for genomic targeting of a CAG-FLEX-mStrawberry cassette to the mouse Rosa26 locusDepositorInsertCAG-FLEX-mStrawberry flanked by Rosa26 homology arms (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-Synaptojanin 1-170
Plasmid#22292DepositorInsertSynaptojanin 1_170 (SYNJ1 Human)
TagsFlagExpressionBacterial and MammalianMutationK334R compared to Genbank ID NM_003895Available SinceOct. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mNeongreen
Plasmid#169226PurposeTargeting vector backbone to support a knock-in of mNeongreen-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mNeongreen
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-PTPRD-WT
Plasmid#25642DepositorInsertProtein tyrosine phosphatase receptor-type delta (PTPRD Human)
UseLentiviralExpressionMammalianMutationAn NsiI restriction site was engineered into the …Available SinceApril 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-MIB1-IRES-Puro
Plasmid#140240PurposeLentiviral vector expressing flag-tagged MIB1DepositorAvailable SinceJune 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mScarlet
Plasmid#169219PurposeTargeting vector backbone to support a knock-in of Linker-mScarlet at the C-terminus of a target locusDepositorInsertDouble SapI flanked mScarlet
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-GFP-LoxP-SNAP-TERT
Plasmid#71391PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes GFP marker flanked by LoxP sites for selection.DepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
2xMARS
Plasmid#205233PurposeExpresses two repeats of PLEKHA5 aa 143-271 (K163A and R164A) fused to mScarlet-iin mammalian cellsDepositorInserttwo repeats of PLEKHA5 aa 143-271 with K163A and R164A mutations (PLEKHA5 Human)
TagsNuclear Export Sequence and mScarlet-iExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CANX
Plasmid#227280PurposeDonor template for mStayGold insertion into the C-terminus of the CANX locus. For ER visualization. To be co-transfected with sgRNA plasmid px330-CANX (Addgene #227279)DepositorInsertCANX Homology Arms flanking a mStayGold Tag (CANX Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-NbmiR482aTS-B/c
Plasmid#227967PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Nicotiana benthamiana.DepositorInsertsB/c
NbmiR482aTS
ExpressionPlantPromoter35S and NoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-miRFP670nano3-Blast-H3C2
Plasmid#207784PurposeDonor template for miRFP670nano3-2A-Blast insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3-Blast Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR-AmCyan
Plasmid#138481PurposeFor cloning sgRNA flanked by two ribozyme elements, to subsequently cloned into PL-5LTR-GW-A vector.DepositorInsertAmCyan
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pInt-ERCreER
Plasmid#190040PurposeThis is an integration donor plasmid to insert a DNA fragment for doxycycline inducible ERT2-Cre-ERT2 at the AAVS1 locus. It works with an AAVS1 targeting CRISPR/Cas9 construct (Addgene #72833).DepositorInsertERT2-Cre-ERT2 flanked by AAVS1
UseCRISPR and TALENExpressionMammalianAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT-sox10-cytoBirA-2A-mCherry_Ras
Plasmid#80062PurposeSox10 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterSox10 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mTurquoise2
Plasmid#169222PurposeTargeting vector backbone to support a knock-in of mTurquoise2-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mTurquoise2
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-TUBA1B
Plasmid#227321PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorInsertTUBA1B Homology Arms flanking a Puro-2A-mStayGold Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-EMTB-TurboID-V5
Plasmid#190736PurposeMammalian expression of EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertensconsin (MAP7 Human)
TagsMyc, TurboID, and V5ExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino ac…PromoterCMVAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-MAPRE1
Plasmid#227324PurposeDonor template for mStayGold insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mStayGold Tag (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mNeongreen
Plasmid#169227PurposeTargeting vector backbone to support a knock-in of Linker-mNeongreen at the C-terminus of a target locusDepositorInsertDouble SapI flanked mNeongreen
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-GW-A
Plasmid#138480PurposeFor expression of ribozyme-flanked sgRNA after the Gateway (GW) LR cloning.DepositorInsertGateway attR1/R2 cassette with chloramphenicol resistance and ccdB genes
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mScarlet
Plasmid#169218PurposeTargeting vector backbone to support a knock-in of mScarlet-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mScarlet
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBetaActin-FKBP-mScarlet-Dync1h1motor
Plasmid#191330PurposeExpresses the fluorescently labeled dynein motor domain fused to dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-mScarlet-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR-DMD-Donor
Plasmid#60605PurposeKnock-in donor vector to insert Exon 44 in front of Exon 45 of human DYSTROPHIN (DMD)gene, include EF1a-hygromycin resistance cassette flanked by loxP sequences.DepositorInsertHygromycin resistant gene
UseKnock-in donor vectorExpressionMammalianAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pME-lox-3xSTOP-lox (JDW 869)
Plasmid#224521PurposeA Gateway compatible middle entry clone containing a loxP flanked SV40 polyA, bGH polyA, and SV40 pA stop cassetteDepositorInsertLoxP-3xStop-LoxP
UseCre/LoxAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mTurquoise2
Plasmid#169223PurposeTargeting vector backbone to support a knock-in of Linker-mTurquoise2 at the C-terminus of a target locusDepositorInsertDouble SapI flanked mTurquoise2
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTub-alpha1-EB3-NeonGreen-T2A-iLifeact-mCherry
Plasmid#175261Purposelabelling of microtubule plus end and F-actin structuresDepositorInsertEB3-NeonGreen-T2A-iLifeact-mCherry (MAPRE3 Human)
TagsmCherry (on iLifeact) and mNeonGreen (on EB3)ExpressionMammalianMutationNone (wt)PromoterpTub-alpha1Available SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only