We narrowed to 15,360 results for: gRNA
-
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDAS12230_pegRNA-PEAR-GFP(10PBS-24RT)-mCherry
Plasmid#177182Purposeplasmid expressing a pegRNA targeting the PEAR-GFP plasmid along with an mCherry markerDepositorInsertpegRNA targeting the PEAR-GFP plasmid
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-RNF2-tevopreQ1-epegRNA+5G>T_EF1a-puroR
Plasmid#207355PurposeLentiviral transfer plasmid encoding hU6-driven expression of a RNF2 engineered prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertRNF2 + 5G>T tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEM047 [T7-assisted CROPseq sgRNA expression vector]
Plasmid#224899PurposeLentiviral CROP-seq vector with lineage barcode cassette and T7 promoter for ID amplification from cDNADepositorInsertseGFP
LacZ fragment (removed by digestion with BstXI/BlpI for sgRNA cloning)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-Ezr sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179119PurposeExpresses Ezr sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertEzr sgRNA
UseAAVTagsExpressionMutationPromoterU6Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMammalianMutationPromoterU1a and U6Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-gRNA-UbC-eGFP-P2A-Bsr
Plasmid#83925PurposeLentiviral SpCas9-gRNA expression vector with eGFP-P2A-BlastRDepositorInsertseGFP
Bsr
UseCRISPR and LentiviralTagsP2AExpressionMutationPromoterhUbCAvailable sinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6 and short human rhodopsin promoterAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK- mRFP-T2A-PuroR
Plasmid#194925PurposemRFP and T2A linker are inserted in between the hPGK promoter and the puromycin resistance gene (PuroR) on pGL3-U6-sgRNA-PGK-puromycin to allow simultaneous monitoring and enrichment of transfected hoDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterhPGKAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd gRNA4 (FWA)
Plasmid#115486PurposeCRISPR-Cas9 SunTag system to target NtDRMcd to the FWA locus with a single guide RNADepositorInsertg4_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX(Cas12k-TniQ-TniQ)-sgRNA_entry (CJT112)
Plasmid#181791PurposeExpresses 3-component ShHELIX containing a Cas12k-TniQ-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShCas12k-ShTniQ-ShTniQ
UseTagsExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX552-EF1a-DIO-mcherry(with gRNA scaffold)
Plasmid#199581PurposeExpresses mCherry in a Cre-dependent mannerDepositorInsertmCherry
UseAAV, CRISPR, and Cre/LoxTagsExpressionMammalianMutationPromoterEF1a intron A and U6Available sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLQ-Pxyl/tet-cas9-Pj23119-sgRNA
Plasmid#92121PurposeCRISPR-Cas9 based efficient genome editing in S. aureusDepositorInsertCas9-Pxyltet-sgRNA-pj23119
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
TBP6.7 non-targeting gRNA lambda phage
Plasmid#132547Purposeexpresses gRNA for TBP-based CIRTSDepositorInsertgRNA TBP-based CIRTS
UseTagsExpressionMammalianMutationPromoterhU6 promoterAvailable sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA1
Plasmid#117405PurposeSpyCas9 sgRNA 1 targeting TLR2.0DepositorInsertSpyCas9 sgRNA targeting TLR 2.0
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.Control
Plasmid#128749PurposeExpresses control gRNADepositorInsertControl sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermU6Available sinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
SLBP non-targeting gRNA lambda phage
Plasmid#132548Purposeexpresses gRNA for SLBP-based CIRTSDepositorInsertgRNA SLBP-based CIRTS
UseTagsExpressionMammalianMutationPromoterhU6 promoterAvailable sinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRRL-gRNA(anti-cGAS)-Cas9-Puro
Plasmid#130908PurposegRNA targeting human cGAS; Cas9 insert; Puromycin selection markerDepositorInsertCas9
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-Fermt2 sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179117PurposeExpresses Fermt2 sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertFermt2 sgRNA
UseAAVTagsExpressionMutationPromoterU6Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-gRNA scaffold (SpyCas9)
Plasmid#113039PurposeAAV vector; encodes GFP as well as a U6-driven gRNA scaffold (SpyCas9)DepositorInsert2x BbsI sites - SpCas9 scaffold, co-expressed GFP (transfection marker)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP160-pU6-sgRNA
Plasmid#158987PurposeVector D encodes pAAV-pMecp2-dSaCas9-VP160-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP160
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpMecp2Available sinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)sgRNA_CAG-Cas9-bpA_EF1-TagRFP
Plasmid#86987PurposeFor cloning and expression of sgRNA together with expression of Cas9 and TagRFPDepositorInsertCas9
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-p53 gRNA-Cas9-T2A-mCherry
Plasmid#164256PurposeTranscription of p53 guide RNA and Cas9 expression for CRISPR/Cas9 in mammalian cellsDepositorInsertsg p53
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV_mU6-sgASCL1_hU6-sgRNA_hUbC-PuroR-P2A-GFP
Plasmid#162337PurposeLentiviral expression of sgASCL1 paired with a second S. pyogenes sgRNA with a GFP-P2A-PuroR selection markerDepositorInsertS. pyogenes sgRNA
UseLentiviralTagsExpressionMammalianMutationPromoterhU6; mU6Available sinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6-Slc1a3 sgRNA; EF1a-dCas9-KRAB-GFP
Plasmid#194283PurposeEF1a-dCas9-KRAB-GFP with Slc1a3 sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterEF1aAvailable sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pShCAST(Cas12k-TniQ-TniQ)-sgRNA_entry (CJT12)
Plasmid#181788PurposeExpresses 3-component ShCAST containing a Cas12k-TniQ-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShTnsB, ShTnsC, ShCas12k-ShTniQ-ShTniQ
UseTagsExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available sinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM124: pAAV-EFS-CasRx-VEGFA presgRNA
Plasmid#166872PurposeAAV vector for expressing CasRx and human VEGFA targeting presgRNA for RNA-editingDepositorInsertsU6-VEGFA presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationPromoterEFS and U6Available sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA2
Plasmid#117406PurposeSpyCas9 sgRNA 2 targeting TLR2.0DepositorInsertSpyCas9 sgRNA targeting TLR 2.0
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
BC1441-mouse U6-3xsgRNAs (TS5, TS6, TS7)
Plasmid#164040PurposeExpression of three sgRNAs (sgTS5, sgTS6, sgTS7) for targeting to CRISPR-Tag_V2DepositorInsertsgTS5-sgTS6-sgTS7
UseCRISPRTagsExpressionMutationPromotermouse U6Available sinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-AsCas12a-TLR-MCV1-gRNA
Plasmid#117411PurposeAsCas12a-gRNA targeting TLR2.0DepositorInsertAsCas12a gRNA targeting TLR 2.0
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
1782_pAAV-U6-Ai9-Sa-gRNA2-CB-SACas9-HA-OLLAS-spA_C
Plasmid#135978PurposegRNA against the right loxP site of the Ai9 alleleDepositorInsertAi9 gRNA2
UseAAV, CRISPR, and Mouse TargetingTagsHAExpressionMutationPromoterCBAvailable sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
1781_pAAV-U6-Ai9-Sa-gRNA1-CB-SACas9-HA-OLLAS-spA_C
Plasmid#135979PurposegRNA against the left loxP site of the Ai9 alleleDepositorInsertAi9 gRNA1
UseAAV, CRISPR, and Mouse TargetingTagsHAExpressionMutationPromoterU6Available sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-Scaffold-cTNT-SaCas9-HA-OLLAS
Plasmid#209781PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA scaffold by U6 promoterDepositorInsertcTNT
UseAAVTagsHA and OLLASExpressionMutationPromotercTNTAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-OLLAS
Plasmid#209782PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoterDepositorInsertsgRNA
UseAAVTagsHA and OLLASExpressionMutationPromotercTNTAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-pegRNA-tetra-com vector
Plasmid#136271PurposeExpresses PE2 and Tetra-com modified pegRNA cassetteDepositorInsertPE2 and pegRNA cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA BfuAI stuffer A-tract
Plasmid#138525PurposeExpresses a guide RNA of choice cloned into the BfuI site extended at the 3' end to incorporate a 220-nt control A-tract repeat RNA sequence.DepositorInsertControl non-PRC2 binding A-tract repeat RNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only