-
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-P2A-Puro
Plasmid#110848PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGExpressionMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLN552 (FuGW-S(USF1)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe)
Plasmid#105202PurposeModule 1 - synthetic promoter USF1 drives self-inhibiting GAD expression (see PMID: 29056342 for detailed information)DepositorInsertS(USF1)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe
UseLentiviral and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 extracellular-cysteineless (NT864)
Plasmid#49069PurposeExpresses human NKCC1 mutant lacking extracellular cysteine residues and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
UseTags3x Flag and mVenusExpressionMammalianMutationC563S,C568S,C577S,C582S in hNKCC1 in NT17PromoterCMVAvailable sinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235302PurposeComMAND closed-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF1a (human EF1a)Available sinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB035
Plasmid#217834PurposeBacterial expression of human AP3D1 (1-617) and AP3S1 AP-3 core hemicomplexDepositorUseTagsGSTExpressionBacterialMutationRemoved residues 618-1153 from AP3D1PromoterAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB053
Plasmid#217835PurposeBacterial expression of human AP3B1 (1-677) and AP3M1 AP-3 core hemicomplexDepositorUseTagsGSTExpressionBacterialMutationRemoved residues 678-1094 from AP3B1PromoterAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-EGFP(miRE.FF4)-FMRP-TS.FF6x1-bGH
Plasmid#235266PurposeComMAND EGFP-FMRP open-loop circuitDepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseSynthetic BiologyTagsFLAGExpressionMammalianMutationPromoterEF1a (human EF1a)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-EGFP(miRE.FF4)-FMRP-TS.FF4x1-bGH
Plasmid#235267PurposeComMAND EGFP-FMRP closed-loop circuitDepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseSynthetic BiologyTagsFLAGExpressionMammalianMutationPromoterEF1a (human EF1a)Available sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIV_Rev
Plasmid#236244Purpose3rd generation SIV-based lentiviral packaging plasmid; Contains SIV RevDepositorInsertSIV Rev
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-lexPR-nls-GFP-pA (JDW 1316)
Plasmid#229811PurposeA Tol2 based expression vector for RU486 inducible expression of GFP in the nucleus (1st generation)DepositorInsertLexA transactivator-LexA-Operon-nls-GFP
UseTol2 based expression vectorTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-lexA-oMDC-pA-lexO-cFos-nlsGFP-pA (JDW 1382)
Plasmid#229813PurposeA Tol2 based expression vector for RU486 inducible expression of GFP in the nucleus with a destablized lex transactivator and a c-fos minimal promoter.DepositorInsertLexA-mODC-LexAOp-cFos
UseTol2 based expression vectorTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-LexA-oMDC-pA-LexOp-nlsGFP-pA (JDW 1381)
Plasmid#229838PurposeA Tol2 based expression vector for RU486 inducible expression of GFP in the nucleus with a destablized lex transactivator.DepositorInsertLexA-mODC-LexAOp
UseTol2 based expression vectorTagsExpressionMutationPromoterAvailable sinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Amyloid β42-c_myc
Plasmid#225223PurposeYeast optimized human Amyloid β42 fused with aga2 protein gene under gal1 promoter for the expression of Amyloid β42 in yeast surface display.DepositorInsertsUseTagsHA Tag and c-myc TagExpressionYeastMutationPromoterGAL1Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eA3A-BE5-(NG)-PX458-EGFP
Plasmid#229687PurposeCRISPR CBE plasmid (C to T edits): eA3A-BE5-NG engineered to include the sgRNA cloning backbone from PX458 and EGFP. Includes BbsI sites for sgRNA cloning downstream of U6 promoter.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianMutationPromoterAvailable sinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-α-Synuclein-c_myc
Plasmid#225222PurposeYeast optimized human alpha synuclein fused with aga2 protein gene under gal1 promoter for the expression of alpha synuclein in yeast surface display.DepositorInsertsα-Synuclein
Aga2
UseTagsGS linker, HA Tag, and c-myc TagExpressionYeastMutationPromoterGAL1Available sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-4
Plasmid#228986PurposeFor bacterial expression of anti-GST nanobody GST-4, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-4
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-2
Plasmid#228984PurposeFor bacterial expression of anti-GST nanobody GST-2, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-2
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-7
Plasmid#228989PurposeFor bacterial expression of anti-GST nanobody GST-7, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-7
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-9
Plasmid#228968PurposeFor bacterial expression of anti-GFP nanobody LaG94-9, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-9
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-10
Plasmid#228969PurposeFor bacterial expression of anti-GFP nanobody LaG94-10, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-10
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-1--LaG94-14
Plasmid#228973PurposeFor bacterial expression of anti-GFP nanobody dimer of LaG94-1 and LaG94-14, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertLaG94-1--LaG94-14
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-12
Plasmid#228970PurposeFor bacterial expression of anti-GFP nanobody LaG94-12, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-12
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-3
Plasmid#228963PurposeFor bacterial expression of anti-GFP nanobody LaG94-3, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-3
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-38
Plasmid#228979PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-38, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertLaTdT-38
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-8
Plasmid#228967PurposeFor bacterial expression of anti-GFP nanobody LaG94-8, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-8
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-6
Plasmid#228966PurposeFor bacterial expression of anti-GFP nanobody LaG94-6, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-6
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-18
Plasmid#228972PurposeFor bacterial expression of anti-GFP nanobody LaG94-18, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-18
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaRIgG-2
Plasmid#228996PurposeFor bacterial expression of anti-rabbit IgG nanobody LaRIgG-2, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaRIgG-2
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-1
Plasmid#228983PurposeFor bacterial expression of anti-GST nanobody GST-1, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-1
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaGIgG-12
Plasmid#228999PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-12, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaGIgG-12
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-2
Plasmid#228975PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-2, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaTdT-2
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaGIgG-4
Plasmid#228998PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-4, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaGIgG-4
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-15
Plasmid#228971PurposeFor bacterial expression of anti-GFP nanobody LaG94-15, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-15
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-3
Plasmid#228985PurposeFor bacterial expression of anti-GST nanobody GST-3, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-3
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaMIgG-14
Plasmid#228994PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-14, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaMIgG-14
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-2
Plasmid#228962PurposeFor bacterial expression of anti-GFP nanobody LaG94-2, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-2
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-5
Plasmid#228965PurposeFor bacterial expression of anti-GFP nanobody LaG94-5, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-5
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-1
Plasmid#228961PurposeFor bacterial expression of anti-GFP nanobody LaG94-1, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-1
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaMIgG-9
Plasmid#228993PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-9, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaMIgG-9
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-1
Plasmid#228974PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-1, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaTdT-1
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaRIgG-7
Plasmid#228997PurposeFor bacterial expression of anti-rabbit IgG nanobody LaRIgG-7, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaRIgG-7
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-44
Plasmid#228981PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-44, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertLaTdT-44
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-45
Plasmid#228982PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-45, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertLaTdT-45
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaMIgG-8
Plasmid#228992PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-8, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaMIgG-8
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-10
Plasmid#228978PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-10, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaTdT-10
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaRIgG-1
Plasmid#228995PurposeFor bacterial expression of anti-rabbit IgG nanobody LaRIgG-1, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaRIgG-1
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-8
Plasmid#228990PurposeFor bacterial expression of anti-GST nanobody GST-8, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-8
UseTags6xHISExpressionBacterialMutationPromoterT7Available sinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only