We narrowed to 12,964 results for: BASE
-
Plasmid#137823Purposeexpression of CD44 proteins in mammalian cellsDepositorAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only
-
dCas9-dMSK1
Plasmid#165602PurposeExpresses Sp dCas9 fused to truncated human MSK1 (42-802)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated human Mitogen- and stress-activated protein kinase-1 (42-802) (RPS6KA5 S. Pyogenes, Synthetic, Human)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianPromoterEF1aAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV7.1_3xFLAG-LATS2
Plasmid#172987Purposeconstitutive expression of FLAG-tagged LATS2DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-15
Plasmid#228971PurposeFor bacterial expression of anti-GFP nanobody LaG94-15, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-15
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOM20*-SBP-GFP
Plasmid#120173PurposeExpresses a chimera of the mitochondria-targeting signal of TOM20, SBP tag and GFP (fluorescent tag)DepositorInsertMitochondrial import receptor subunit TOM20 homolog (TOMM20 Human)
TagsSBP and eGFPExpressionMammalianMutationTruncated TOM20: 1-30 aaPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA CFP hNKCC1 WT (NT15-H)
Plasmid#49077PurposeExpresses human NKCC1 with an N-terminal 3xHA-CFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x HA and mCeruleanExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-EGFP-GRAM-H
Plasmid#211703PurposeLentiviral expression of EGFP-tagged GRAM domain of GRAMD1b carrying a G187L mutation (pLJM1-EGFP-GRAM1b G187L)DepositorInsertEGFP-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseLentiviralTagsEGFPExpressionMammalianMutationChanged Glycine 187 to LeucinePromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGLOW79
Plasmid#177339PurposeC. elegans mNeonGreen co-injection markerDepositorInsertPmyo-3::mNeonGreen
TagsmNeonGreenExpressionWormPromotermyo-3Available SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T7-6h-GST-α-Synuclein
Plasmid#225224PurposeAlpha synuclein gene fused with gst gene under t7 promoter for bacterial expression of alpha synuclein protein.DepositorInsertsGST
α-Synuclein
Tags6xHis Tag and TEV Cleavage SiteExpressionBacterialPromoterT7Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpCas9-NG-P2A-EGFP (RTW4564)
Plasmid#140005PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9-NG with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpCas9-NG=L1111R/D1135V/G1218R/E121…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v2-10 (fl)
Plasmid#137824Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v2-10 (fl) (CD44 Human)
TagsGFPExpressionMammalianMutationfull length and mutations A282T, T483A, N535D, S5…PromoterPGKAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-8
Plasmid#228990PurposeFor bacterial expression of anti-GST nanobody GST-8, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-8
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H326
Plasmid#228242PurposemT2Del_EPACdDEPCD_Q270E_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H327
Plasmid#228243PurposemT2Del_EPACdDEPCD_Q270E_M312L_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_M312L_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H328
Plasmid#228244PurposemT2Del_EPACdDEPCD_Q270E_M312L_E325T_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_M312L_E325T_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H329
Plasmid#228245PurposemT2Del_EPACdDEPCD_Q270E_E325T_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_E325T_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2a KI
Plasmid#131486PurposeEndogenous tagging of GluN2a: N-terminal (amino acid position: A25)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
dCas9-ddMSK1
Plasmid#165603PurposeExpresses Sp dCas9 fused to truncated inactive human MSK1 (42-802, D195A, D565A)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated inactive human Mitogen- and stress-activated protein kinase-1 (42-802, D195A, D565A) (RPS6KA5 S. Pyogenes, Synthetic, Human)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianPromoterEF1aAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2b KI
Plasmid#131487PurposeEndogenous tagging of GluN2b: N-terminal (amino acid position: S34)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP3
Plasmid#79875PurposeBacillus subtilis sgRNA expression vector; integrates into thrCDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti NL
Plasmid#113450PurposeLentiviral NanoLuc control expression vectorDepositorInsertNanoLuc
UseLentiviral and LuciferaseTagscmycExpressionMammalianPromoterhUbCAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P1-hPXR-LBD
Plasmid#67769PurposeExpression GST-hPXR-LBD in bacteriaDepositorInserthuman pregnane X receptor (PXR) ligand binding domain (NR1I2 Human)
TagsGSTExpressionBacterialMutationContains amino acids 107 to 434 of human PXRPromoterTacAvailable SinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H188
Plasmid#170349PurposemT2Del_EPACdDEPCD_tdcp173Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_tdcp173Ven(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-B-GRAM-W-NeoR
Plasmid#211710PurposeLentiviral expression of a dimerization-dependent fluorescent protein (ddFP) subunit (B) fused with the GRAM domain of GRAMD1b carrying a G187W mutation (B-GRAM-W)DepositorInsertB-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseLentiviralTagsddFP-B3ExpressionMammalianMutationChanged Glycine 187 to TryptophanPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER21-puro_TAOK1
Plasmid#209777Purposedoxycycline-inducible expression of TAOK1DepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPtGE34
Plasmid#107932PurposeExpresses Cas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
UseCRISPR and Synthetic Biology; Episomal vector for…Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
B-GRAM-W
Plasmid#211707PurposeExpression of a dimerization-dependent fluorescent protein (ddFP) subunit (B) fused with the GRAM domain of GRAMD1b carrying a G187W mutation (B-GRAM-W) in mammalian cellsDepositorInsertB-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
TagsddFP-B3ExpressionMammalianMutationChanged Glycine 187 to TryptophanPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC
Plasmid#62806PurposeTo express genes at high levels in neuronal cells. This UbC promoter is more active in neurons than the promoter in CMV-based vectors.DepositorTypeEmpty backboneUseAAV; EucaryoticExpressionMammalianPromoterhUbCAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ACTB
Plasmid#207748PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of ACTB for knock-in.DepositorAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-LAMP1
Plasmid#227322PurposeDonor template for mStayGold insertion into the C-terminus of the LAMP1 locus. For lysosome visualization. To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a mStayGold Tag (LAMP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mScarlet-LMNB1
Plasmid#207771PurposeDonor template for mScarlet insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a mScarlet Tag (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
single polypeptide FPX biosensor for calcium ion
Plasmid#60887PurposeFPX biosensorDepositorInsertsingle polypeptide FPX biosensor for calcium ion
TagsHindIII siteExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-LMNB1
Plasmid#227329PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorInsertLMNB1 Homology Arms flanking a Puro-2A-mStayGold (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEM-GFP-URA3-GFP
Plasmid#72606PurposeTemplate for creating a C-terminal GFP tag AND an internal GFP tag from a single transfection of yeastDepositorInsertsGFP (full)
URA3
GFP (partial)
Optional Linker
MutationIncludes full 819 bp coding sequence of URA3, 435…Available SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-B-GRAM-H-NeoR
Plasmid#211709PurposeLentiviral expression of a dimerization-dependent fluorescent protein (ddFP) subunit (B) fused with the GRAM domain of GRAMD1b carrying a G187L mutation (B-GRAM-H)DepositorInsertB-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseLentiviralTagsddFP-B3ExpressionMammalianMutationChanged Glycine 187 to LeucinePromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v3 (fl)
Plasmid#137814Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v3 (fl) (CD44 Human)
TagsGFPExpressionMammalianMutationfull length and N280D in the V3 regionPromoterPGKAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
PM-RA
Plasmid#211705PurposeExpression of a dimerization-dependent fluorescent protein (ddFP) subunit (RA) fused with plasma membrane (PM) targetting motif of Lck in mammalian cellsDepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
B-GRAM-H
Plasmid#211706PurposeExpression of a dimerization-dependent fluorescent protein (ddFP) subunit (B) fused with the GRAM domain of GRAMD1b carrying a G187L mutation (B-GRAM-H) in mammalian cellsDepositorInsertB-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
TagsddFP-B3ExpressionMammalianMutationChanged Glycine 187 to LeucinePromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only