We narrowed to 10,106 results for: UTY
-
Plasmid#156429PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationDELTA1-265Available SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN515 - pTRE3G-CTCF(ZFmut)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156434PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA (all Zinc fingers point mutated), targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationAll zinc fingers mutatedAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON.BA.2-RBD
Plasmid#184830PurposeMammalian cell expression of RBD of SARS-CoV-2 spike protein of variant OMICRON.BA.2 with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-OMICRON.BA2-RBD (S Severe acute respiratory syndrome coronavirus 2)
Tags6X His tagExpressionMammalianMutationSARS-CoV-2 Spike RBD protein of OMICRON.BA.2 vari…Available SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-gamma-2 in pcDNAI/Amp
Plasmid#55777PurposeA C-terminal CFP fragment was fused to Ggamma-2. When co-expressed with an N-terminal mCerulean, CFP, or YFP fragment fused to a Gbeta subunit with which it interacts a fluorescent signal is produced.DepositorInsertCFP(159-238)-gamma-2 (GNG2 Aequorea victoria, Human)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-CR-PINK1-C-TAP
Plasmid#128510PurposeLentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag.DepositorInsertPTEN induced kinase 1 (PINK1 Human)
UseLentiviralTagsFLAG and HA tagsExpressionMammalianMutationSynonymous silent mutation in Q5 to render sgRNA …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-o-YFP
Plasmid#55776PurposeThis G protein alpha-o construct contains internal insertions of YFP and the EE epitopeDepositorInsertG protein alpha-o internally tagged with EYFP and EE epitope (Gnao1 Rat)
TagsEE epitope was introduced internally with D167E a…ExpressionMammalianMutationA BglII site was removed from the 5' untrans…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAU003 - pTRE3G-Cterm_Nterm_switch_CTCF-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156430PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationCterm_Nterm_switchedAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON.BA.1-RBD
Plasmid#184831PurposeMammalian cell expression of RBD of SARS-CoV-2 spike protein of variant OMICRON.BA.1 with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-OMICRON.BA.1 (S Severe acute respiratory syndrome coronavirus 2)
Tags6X His tagExpressionMammalianMutationSARS-CoV-2 Spike RBD protein of OMICRON.BA.1 vari…Available SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
PBRPyCAG-LoxP-ERAS-STOPcassette-Loxp-DsRed-IRES-PURO
Plasmid#52419PurposeConstitutive mammalian expression of ERAS. Upon CRE mediated deletion of ERAS insert, dsRED expression markers is truned on due to concomittant removal of stop cassette.DepositorInsertERAS (ERAS Human)
PromoterCAGGSAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-1
Plasmid#125776Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-1 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-2
Plasmid#125777Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-2 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-beta-5 in pcDNAI/Amp
Plasmid#55763PurposeA carboxyl-terminal CFP fragment was fused to Gbeta-5. When co-expressed with an amino terminal CFP or YFP fragment fused to a Ggamma subunit or RGS7, a fluorescent signal is produced.DepositorInsertCFP(159-238)-beta-5 (GNB5 Aequorea victoria, Human)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN-EIJ
Plasmid#125774Purposeconstitutive expression of a guide RNA targeting an exon-intron junction of human WRNDepositorInsertsgWRN-EIJ (WRN Human)
UseCRISPRAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLIK_hygro_p53(R280K)_V5
Plasmid#136540PurposeLentiviral expression vector for an inducible p53(R280K)-V5DepositorInsertp53(R280K) (TP53 Human)
UseLentiviral; Destinatioin vector for gateway cloni…TagsV5ExpressionMammalianMutationp53(R280K)V5 was cloned from pLenti6-p53-R280K-V5…Available SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgPOLR2D
Plasmid#125769Purposeconstitutive expression of a guide RNA targeting human POLR2D (CRISPR positive control)DepositorInsertsgPOLR2D (POLR2D Human)
UseCRISPRAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/hFGFR3-K650M-V5
Plasmid#214909Purposeexpression of the K650M mutant variant of human FGFR3, which is associated with Severe Achondroplasia with Developmental Delay and Acanthosis Nigricans (SADDAN)DepositorInsertFGFR3 (FGFR3 Human)
TagsV5/HisExpressionMammalianMutationK650M substitutionPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-N317P
Plasmid#196378PurposeMammalian cell expression of SARS-CoV-2 Spike protein with mutation N317P with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-2P-N317P (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRc2_p53(R280K)_V5
Plasmid#136525PurposeUsed as a donor vector to clone into pSLIKDepositorInsertp53(R280K) (TP53 Human)
UseEntry vector for gateway cloningTagsV5Mutationp53(R280K)V5 was cloned from pLenti6-p53-R280K-V5…AvailabilityAcademic Institutions and Nonprofits only -
pT2-shATRX-GFP
Plasmid#124259PurposeExpresses shRNA targeting ATRX with a GFP reporter which is driven by the SV40 promoter. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshATRX
ExpressionMammalianAvailable SinceJuly 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgPlxnb2-2 in pT4-U6-sgRNA-CMV-EGFP
Plasmid#239589Purposeexpresses guide#2 to boost the expression of mouse Plxnb2, via CRISPRaDepositorInsertsgRNA targeting TSS-upstream reagion of Plxnb2 (Plxnb2 Mouse)
UseSleeping beauty (sb) transposonExpressionMammalianPromoterhU6Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgPlxnb2-3 in pT4-U6-sgRNA-CMV-EGFP
Plasmid#239590Purposeexpresses guide#3 to boost the expression of mouse Plxnb2, via CRISPRaDepositorInsertsgRNA targeting TSS-upstream reagion of Plxnb2 (Plxnb2 Mouse)
UseSleeping beauty (sb) transposonExpressionMammalianPromoterhU6Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgPlxnb2-1 in pT4-U6-sgRNA-CMV-EGFP
Plasmid#239588Purposeexpresses guide#1 to boost the expression of mouse Plxnb2, via CRISPRaDepositorInsertsgRNA targeting TSS-upstream reagion of Plxnb2 (Plxnb2 Mouse)
UseSleeping beauty (sb) transposonExpressionMammalianPromoterhU6Available SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196078Purpose(Empty Backbone) Constitutive CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-denAsCas12a(E174R/S542R/K548R/D908A)-NLS(nuc)-3xHA-VPR (RTW776)
Plasmid#107943PurposeMammalian expression plasmid for human codon optimized DNase-inactive enAsCas12a (enhanced AsCas12a) fused to the VPR activation domain, encoding E174R/S542R/K548R/D908A substitutionsDepositorInserthuman codon optimized DNase-inactive (D908A) enAsCas12a (E174R/S542R/K548R) fused to VPR activation domain
Tags3x HA, NLS (nucleoplasmin), and VPR (VP64-p65-Rta…ExpressionMammalianMutationE174R, S542R, K548R and D908APromoterCAGAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
PGKp-GFP-YAP (5SA)
Plasmid#174174PurposeLentiviral vector to constitutively express overactive YAP (5 LATS phosporylation sites mutated to Ala) under control of the human PGK promoter.DepositorInsertYAP (YAP1 Human)
UseLentiviralTags3x FLAG tagExpressionMammalianMutationFive LATS phosphorylation sites (S61, S109, S127,…PromoterPGKAvailable SinceAug. 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV[TetOn]-Puro-TRE3G>mNeurog2
Plasmid#198754PurposeVector encodes the gene for murine neurogenin-2 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
EFSp-GFP-YAP (5SA)
Plasmid#174170PurposeLentiviral vector to constitutively express overactive YAP (5 LATS phosporylation sites mutated to Ala) under control of the EFS promoter.DepositorInsertYAP (YAP1 Human)
UseLentiviralTags3x FLAG tagExpressionMammalianMutationFive LATS phosphorylation sites (S61, S109, S127,…PromoterEFSAvailable SinceSept. 28, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEN366 - pTRE3G-CTCF-mRuby2-BGHpA-CAGGS-rtta3G-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE donor
Plasmid#156432PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible wild-type CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV[TetOn]-Puro-TRE3G>mAscl1
Plasmid#198755PurposeVector encodes the gene for murine Ascl1 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-M1-di-Ub(G76V)-HOIL-1
Plasmid#229539PurposeConstitutively active M1-di-ubiquitin HOIL-1 fusion protein for expression in E. coliDepositorTags6xHis-3CExpressionBacterialMutationChanged Gly 76 to Val and changed Gly 76 to ValPromoterT7Available SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON.BA.2
Plasmid#184829PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON.BA.2 with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-OMICRON.BA.2 (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-1 in pcDNAI/Amp
Plasmid#54468PurposeAn amino-terminal YFP fragment was fused to Gbeta-1. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP (1-158)/beta-1 (GNB1 Aequorea victoria, Human)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-1 was amplified via PCR, which removed an i…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196076Purpose(Empty Backbone) Constitutive CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgMYC
Plasmid#125770Purposeconstitutive expression of a guide RNA targeting human MYC (CRISPR positive control)DepositorInsertsgMYC (MYC Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-2 in pcDNAI/Amp
Plasmid#54469PurposeAn amino-terminal YFP fragment was fused to Gbeta-2. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-2 (GNB2 Aequorea victoria, Human)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196074Purpose(Empty Backbone) Constitutive CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-5 in pcDNAI/Amp
Plasmid#54470PurposeAn amino-terminal YFP fragment was fused to Gbeta-5. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-5 (GNB5 Aequorea victoria, Human)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…Available SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-beta-1 in pcDNAI/Amp
Plasmid#55592PurposeA carboxyl-terminal CFP fragment was fused to Gbeta-1. When co-expressed with an amino-trerminal CFP or YFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertCFP (159-238)-Beta 1 (GNB1 Aequorea victoria, Human)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-SARS-CoV-2-S-Bel-P5_5-7-IRES-mNeonGreen-NES/PKI-P2A-Blasticidin
Plasmid#237480PurposeEncodes full-length SARS-CoV-2 Spike protein (Belgium/GHB-03021 isolate), featuring the E484D substitution, which likely emerged during passaging and enhances TMEM106B binding.DepositorInsertSARS-CoV-2 Spike protein (Belgium/GHB-03021 isolate)
UseLentiviralTagsIRES-mNeonGreen-NES/PKI and P2A-BlasticidinExpressionMammalianMutationS484D + S813I + deleted amino acids 68-76 + 676-6…PromoterCMVAvailable SinceJuly 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT3EF1aH-myr-Akt
Plasmid#179909PurposeThis plasmid is in the pT3-EF1a vector without loxP sites flanking the inverted repeats of SB (sleeping beauty) sequence. Therefore this plasmid can be used with Cre for in vivo studies.DepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-HIF2a dPA (P405A, P531A)
Plasmid#232954PurposeStably express a constitutively stable version of HIF2a (HIF2a dPA)DepositorAvailable SinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-OMICRON
Plasmid#180593PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertSpike (S-GSAS-2P-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-RtoK
Plasmid#194559PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R > K" variantDepositorInsertHMGB1 (HMGB1 Human)
TagsmEGFPExpressionMammalianMutationR > K substitutions after Lys185Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-KtoR
Plasmid#194560PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "K > R" variantDepositorInsertHMGB1 (HMGB1 Human)
TagsmEGFPExpressionMammalianMutationK > R substitutions after Lys185Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-RorKtoA
Plasmid#194558PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R or K > A" variantDepositorInsertHMGB1 (HMGB1 Human)
TagsmEGFPExpressionMammalianMutationR or K > A substitutions after Lys185Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-RtoA
Plasmid#194557PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "R > A" variantDepositorInsertHMGB1 (HMGB1 Human)
TagsmEGFPExpressionMammalianMutationR > A substitutions after Lys185Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRT006.3 L1 dual-luciferase AI retrotransposition reporter
Plasmid#213031PurposeBi-directional luciferase antisense intron (firefly fluc AI) human LINE-1 retrotransposition reporter (ORFeus-Hs sequence) for sleeping beauty integrationDepositorInsertTet-On Human LINE-1 (ORFeus-Hs) Firefly + Renilla Luciferase Antisense Intron dual retrotransposition marker
UseLuciferaseTagsFirefly luciferase antisense intron (3' UTR)ExpressionMammalianPromoterpTRE bidirectional tet-onAvailable SinceJuly 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKT-IDH1(R132H)-IRES-Katushka
Plasmid#124257PurposeExpresses IDH1 with a R132H mutation and katushka fluorescent reporter. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertIsocitrate dehydrogenase 1 (R132H) (IDH1 Human)
ExpressionMammalianMutationArginine 132 is mutated to Histidine. This mutati…Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMS1550
Plasmid#29263PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle79 (GABRA6 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 21, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits