We narrowed to 14,204 results for: RING;
-
Plasmid#114103Purposefusion protein of Gaussia luciferase variant slow burn, Volvox channelrhodopsin-1, and enhanced yellow fluorescent protein (luminopsin LMO3) for bioluminescent optogeneticsDepositorInsertsbGLuc-VChR1-EYFP
UseAAVExpressionMammalianPromotermotoneuron-specific Homeobox 9 promoterAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB-rDA3m
Plasmid#208708PurposeExpresses the genetically-encoded fluorescent dopamine (DA) sensor GRAB_rDA3m in neurons in a cre-dependent mannerDepositorInsertGPCR activation based dopamine (DA) sensor GRAB_rDA3m
UseAAVPromoterhSynAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLS13-IL-10
Plasmid#209128PurposeTransient mammalian expression of IL-10DepositorInsertIL-10 (IL10 Human)
ExpressionMammalianAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GCaMP 6m-p2A-ChRmine-Kv2.1-WPRE
Plasmid#131004Purposebicistronic AAV vector to express GCaMP6m and soma-targeted ChRmine under the control of human Synapsin promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsKv2.1-HAPromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TBK1-C-FLAG-HA
Plasmid#131792PurposeLentiviral vector expressing WT TBK1 containing STOP codonDepositorInsertTBK1 WT (TBK1 Human)
UseLentiviralTagsSTOP codonExpressionMammalianMutationWT full lengthPromoterCMVAvailable SinceOct. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.CD19-FMC63.218.CAR-2G
Plasmid#194457PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); 4-1BB & CD3ζ (signaling domains); anti-CD19 from FMC63 in VL-VH order and 218 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-CD19 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-Synaptojanin 1-145
Plasmid#22291DepositorAvailable SinceOct. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pU6-ACTA2_gRNA1-SpCas9-T2A-GFP
Plasmid#126706Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human ACTA2 locus at the end of the endogenous coding sequenceDepositorInsertACTA2_gRNA1-SpCas9-T2A-GF (ACTA2 Human)
UseCRISPRAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIG-705pUC19-tNGFR-P2A-STAT5b
Plasmid#186103PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR-460 tNGFR-P2A-STAT4
Plasmid#186075PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-iCasp9-P2A-HLA-E SCT-T2A-hCD55-E2A-neo-AAVS1
Plasmid#205444Purposehuman AAVS1-targeting plasmid for expression of human CD46, HLA-G SCT, CD47, and CD59DepositorInsertiCasp9-HLA-E SCT-hCD55
ExpressionMammalianPromoterEF1aAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xMyc-Ku-IRES-Hygro
Plasmid#234950PurposeHuman codon optimized Ku (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInserthuman codon optimized Ku with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsMycExpressionMammalianPromoterEF1aAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICOZ-MAG[EF1α-HER1 CD28Z]
Plasmid#218335PurposeDonor plasmid of MAG Transposon with HER1 CAR mammalian expression cassetteDepositorInsertHER1 CAR mammalian expression cassette
ExpressionMammalianAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-[EF1α-HER1 CD28Z]
Plasmid#218339PurposeLentiviral transfer plasmids for mammalian expression HER1 CARDepositorInsertHER1 CAR mammalian expression cassette
UseLentiviralExpressionMammalianAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRLSIN-[EF1α-HER1 4-1BB]
Plasmid#218341PurposeLentiviral transfer plasmids for mammalian expression HER1 CARDepositorInsertHER1 CAR mammalian expression cassette
UseLentiviralExpressionMammalianAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-PI35P2
Plasmid#92419PurposeFluorescent reporter for phosphatidylinositol (3,5)-bisphosphate (PI(3,5)P2). Mouse MCOLN1 residues 1–68 fused to eGFP.DepositorInsertMCOLN1 (Mcoln1 Mouse)
TagseGFPExpressionMammalianMutationSynthetic gene, codon optimized for human.PromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
(114) pcDNA3.1-GFP-Flag-JunB-EPEA
Plasmid#160743PurposeExpresses a GFP tagged JunB with Flag and EPEA tags.DepositorAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
CiDr-VSP L223F/C302S-mCherry pcDNA3.1 (eVSP CSmutant)
Plasmid#140893PurposeExpresses modified Danio rerio VSP without phosphatase activity (inactive mutant of enhanced VSP) fused with mCherry in mammalian celDepositorTagsmCherryExpressionMammalianMutationchanged 223L to F in Dr-VSP (zebrafish TPTE), cha…Available SinceMay 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV_NLS-SaCas9-NLS-VPR
Plasmid#68496PurposeAAV vector containing SaCas9 fused to VPRDepositorInsertSaCas9-VPR
UseAAV and CRISPRTagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB-rDA3mut
Plasmid#208706PurposeExpresses the genetically-encoded fluorescent dopamine (DA) control sensor GRAB_rDA3mut in neuronsDepositorInsertGPCR activation based dopamine (DA) control sensor GRAB_rDA3mut
UseAAVPromoterhSynAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-dnMCAK
Plasmid#205993PurposeOver-expression of GFP-dnMCAKDepositorInsertdnMCAK
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-NbmiR482aTS-B/c
Plasmid#227967PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Nicotiana benthamiana.DepositorInsertsB/c
NbmiR482aTS
ExpressionPlantPromoter35S and NoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC1-IMS-oROS-HT
Plasmid#216419PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to the inter-membrane-space of mitochondria.DepositorInsertoROS-HT
ExpressionMammalianPromoterCMVAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-hCD46-P2A-HLA-G SCT-T2A-hCD47-E2A-hCD59-F2A-neo-AAVS1
Plasmid#205443Purposehuman AAVS1-targeting plasmid for expression of iCasp9, HLA-E SCT, human and CD55DepositorInserthCD46-HLA-G SCT-hCD47-hCD59
ExpressionMammalianPromoterEF1aAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-HSV TK-P2A-H2-Kb SCT-T2A-mCD47-E2A-mCD55-F2A-neo-AAVS1
Plasmid#205446Purposehuman AAVS1-targeting plasmid for expression of HSV TK, H2-Kb SCT, mouse CD47, and mouse CD55DepositorInsertHSV TK-H2-Kb SCT-mCD47-mCD55
ExpressionMammalianPromoterEF1aAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB-rDA2m-IRES-EGFP-CAAX
Plasmid#208694PurposeExpresses the genetically-encoded fluorescent dopamine (DA) sensor GRAB_rDA2m and a membrane-localized EGFP in mammalian cellsDepositorInsertGPCR activation based dopamine (DA) sensor GRAB_rDA2m
ExpressionMammalianPromoterCMVAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2-Eef2TOPm-RLCP-HCVIRES-FL
Plasmid#233629PurposeExpression of bicistronic reporter with mutated TOP motifDepositorInsertPromoter and 5'UTR of Eef2 gene with mutation in TOP motif and HCV IRES (Eef2 Mouse)
UseLuciferaseMutationAGAAGG in TOP motifAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAR17_StrepI_hFASh_H8_pET22b
Plasmid#122846PurposeExpresses human type I fatty acid synthase (FASN) in Escherichia coli. N-terminal Twin-Strep tag; C-terminal H8-tag; in pET22b vector.DepositorInserthuman FASN/ human fatty acid synthase (FASN Human)
TagsHis8 tag and Twin-Strep tagExpressionBacterialMutationwildtypePromoterT7 promoterAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
HsTPC2-EYFP
Plasmid#135194PurposeExpresses tagged TPC2 in mammalian cellsDepositorAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
BLBP-mCherry
Plasmid#63721PurposeExpressing mCherry from BLBP promoter which is a neural stem cell (radial glial cells) specific promoterDepositorInsertBLBP (Fabp7 Mouse)
ExpressionMammalianMutation1700 bp upstream of BLBP gene cloned in CAG-mCher…Promoter1700bp upstream of BLBP geneAvailable SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-Synaptojanin 1-170
Plasmid#22292DepositorInsertSynaptojanin 1_170 (SYNJ1 Human)
TagsFlagExpressionBacterial and MammalianMutationK334R compared to Genbank ID NM_003895Available SinceOct. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
HA-Rab11-DN (S25N)
Plasmid#101046PurposeExpresses HA-tagged human Rab11-DN (S25N) in mammalian cellsDepositorAvailable SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-B5.GS.CAR-3G
Plasmid#194464PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.B5 in VH-VL order & (GGGGS)3 linker (scFv). GFP-Zeo for selection & monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
miniABEMax V82G nSaCas9
Plasmid#135365PurposeExpression of SaCas9 nickase (D10A) with single evolved TadA monomer (ABEMax) with a V82G substitutionDepositorInsertminiABEMax V82G nSaCas9
UseCRISPRExpressionMammalianMutation(V82G)Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
CaMK2rep
Plasmid#239622PurposeCaMKII activity reporter. The plasmid contains sGFP2 fluorescent protein, 3xmyc tags and double phospho-site 3 from rat Synapsin-1a.DepositorInsertSpotNES-sGFP2-SynP3-3xmyc (Syn1 Rat, Synthetic)
TagsSpot, myc, and sGFP2ExpressionMammalianPromoterCMVAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
nCaMK2rep
Plasmid#239624PurposeCaMKII activity reporter. The lentiviral plasmid contains a nanobody sequence (PSD95.FingR), 3xmyc tags and double phospho-site 3 from rat Synapsin-1a.DepositorInsertPSD95.FingR-NES-SynP3-3xmyc (Syn1 Rat, Synthetic)
UseCre/Lox and LentiviralTagsFlag and mycExpressionMammalianPromoterhSynAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV-SB100X[EF1α-copGFP]
Plasmid#218323PurposeDonor plasmid of SB100X Transposon with copGFP mammalian expression cassetteDepositorInsertcopGFP mammalian expression cassette
ExpressionMammalianAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPPC010.AAV
Plasmid#171175PurposeExpression of Sp.pCas9-dCas9, BBa_J23107-MCP-SoxS(R93A/S101A), and hAAVS1 scRNA on pBBR1-KmR plasmidDepositorInsertshAAVS1 scRNA
Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterBBa_J23119 and Sp.pCas9, BBa_J23107Available SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3XFLAG-CMV-14-WDR5
Plasmid#59974PurposeMammalian Expression of WDR5-FLAGDepositorAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
BLBP-GFP
Plasmid#63174PurposeExpressing GFP from BLBP promoter which is a neural stem cell (radial glial cells) specific promoterDepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX:PGRMC1
Plasmid#136062PurposeBacterial expression of pGEX:PGRMC1 to perform a GST-pulldown assay and identify new proteins that interact with GST-PGRMC1 in the human endometrial stroll cells.DepositorInsertProgesterone receptor membrane component 1 (PGRMC1 Human)
TagsGST-PGRMC1ExpressionBacterialAvailable SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQLL-MAG[EF1α-copGFP]
Plasmid#218324PurposeDonor plasmid of MAG Transposon with copGFP mammalian expression cassetteDepositorInsertcopGFP mammalian expression cassette
ExpressionMammalianAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZ853
Plasmid#208115PurposemSwAP-In marker cassette 2 with 5’PB-mNeongreen-HPRT1-BSDDepositorInsertmNeonGreen-HPRT1-BSD
TagsT2AExpressionBacterial and MammalianPromoterEF1alphaAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
139H2_HC
Plasmid#206201PurposeFor recombinant expression of the full heavy chain of the Mouse anti-MUC1 antibody 139H2 in mammalian cells. Includes a C-terminal -His8 tag for purification.DepositorInsertanti-MUC1 antibody 139H2 heavy chain (Ighg1 Mouse)
Tags-AAAHHHHHHHHExpressionMammalianPromoterCMVAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
MBP-CHC(1-1074)-His6
Plasmid#100748PurposeBacterial expression of MBP-tagged clathrin heavy chain large fragment including N-terminal domain, his tagged at C-terminus for purification.DepositorAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB-gDA3mut
Plasmid#208704PurposeExpresses the genetically-encoded fluorescent dopamine (DA) control sensor GRAB_gDA3mut in neuronsDepositorInsertGPCR activation based dopamine (DA) control sensor GRAB_gDA3mut
UseAAVPromoterhSynAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_Dual_epegRNA_tevopreQ1
Plasmid#187454PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4 pegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R pegRNA (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mitoX4-mVenus
Plasmid#185808PurposeMitochondrial targetted (COX8) mVenusDepositorInsertmito-mVenus
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only