We narrowed to 24,790 results for: Spr
-
Plasmid#140198PurposeEpisomal expression of dLbCpf1(D156R)-VPR, variant for culture at room temperature. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdLbCas12a(D156R)-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNase deactivated, D156R for improved activ…PromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
B2M Bulldozer (gRNA crB2M_13)
Plasmid#84381PurposeThis plasmid expresses a gRNA targeting the first exon of human B2M. Most efficient gRNA targeting B2M, leading to ablation of B2M and MHC class I surface expression in 50% of transfected cellsDepositorInsertB2M Bulldozer crB2M_13 gRNA
ExpressionMammalianPromoterhU6 promoterAvailable SinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSc1-DD
Plasmid#80439PurposeExpresses eGFP with ecDHFR along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsE. coli dihydrofolate reductaseExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9
Plasmid#135011PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9DepositorInserthumanized S. pyogenes Cas9
Tags126aa domain from HSV-1 UL12 fused to the N-termi…ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
SunTag-FWAgRNA-4-14aa-TET1cd
Plasmid#106436PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the FWA promoterDepositorInsertgRNA4_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN414aa_OCS (TET1 Human, Synthetic, Mustard Weed)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP325-pAAV-FullH1TO-SaCa9sgRNAi(CREB)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113702PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV, CRISPR, and Mouse TargetingTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCC_12 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-KRAB-dxCas9NG-NLS-2A-Puro-WPRE
Plasmid#139097PurposeExpresses human codon-optimized inactive xCas9-NG fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dxCas9-NG
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, A262T,R324L, S409I, E480K, E543D, M6…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
nCas9-UGI-NLS-P2A-EGFP (pJUL1001)
Plasmid#123611PurposeCAG promoter expression plasmid for hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (BE3 control without rAPOBEC1).DepositorInsertnCas9-UGI-NLS-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 U6-26:gRNA 4 (Pnos):2.1 aptamer (GB1724)
Plasmid#160621PurposeTarget for the Nopaline Synthetase Promoter with the MS2 recognition 2.1 loop in position3' in the scaffoldDepositorInsertU6-26:gRNA 4 (pNos): 2.1 aptamer
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterU6-26Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pJEP310-pAAV-Mecp2P-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113687PurposeSaCas9 driven by the neuron specific promoter Mecp2P. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV-EF1aGFP2AKAT7-linker-mAID-W
Plasmid#159294PurposeLentiviral vector expressing GFP and KAT7 (gRNA-resistant, mAID-tagged) driven by human EF1a promoterDepositorInsertKAT7 (KAT7 Human)
UseLentiviralTagsmAID (auxin-inducible degron)-taggedExpressionMammalianMutationCRISPR sites mutated (gRNA ID. 5 and A10)Promoterhuman EF1a promoterAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pCAG-hMbCas12a-NLS(nucleoplasmin)-3xHA (AAS2134)
Plasmid#114090PurposeCAG promoter expression plasmid for human codon optimized MbCas12a nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized MbCas12a
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCBh_3x Flag-NLS-RhCas12f1-NLS_pA_phU6_gRNA scaffold-spacer_pCMV_mCherry_pA
Plasmid#197025PurposeVector encoding a human codon-optimized RhCas12f1 driven by CBh promoter, guide RNAs compatible with RhCas12f1 driven by hU6, and mCherry driven by CMV promoterDepositorInserthumanized RhCas12f1
ExpressionMammalianPromoterCBh, CMV, hU6Available SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP312-pAAV-CMV-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113689PurposeSaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACSDepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSc1
Plasmid#80436PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCC_07 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-dxCas9-NLS-VPR-2A-Puro-WPRE
Plasmid#139092PurposeExpresses human codon-optimized inactive xCas9 3.7 fused to a transcriptional activator VPR in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertdxCas9 3.7-VPR
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, A262T, R324L,S409I, E480K, E543D, M6…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSc2
Plasmid#80437PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gKAT7-A10)-PGKpuro2ABFP-W
Plasmid#159288PurposeLentiviral vector expressing gRNA targeting KAT7 (gRNA ID. A10)DepositorInsertguide RNA targeting KAT7 (ID. A10) (KAT7 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6 promoterAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonExpressionMammalianPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_4
Plasmid#242899PurposePiggyBac cargo vector with HNRNPK sgRNA 4 for dox-inducible knockdownDepositorAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_1
Plasmid#242897PurposePiggyBac cargo vector with HNRNPK sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_3
Plasmid#242898PurposePiggyBac cargo vector with HNRNPK sgRNA 3 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbVPE1a/b
Plasmid#223218PurposeExpresses an sgRNA targeting the NbVPE1a/b genes in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbVPE1a/b
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MYC_2)-PGKpuroBFP-W
Plasmid#211970PurposeExpress gRNA against MYC with puro and BFPDepositorInsertsgRNA targeting MYC (MYC Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MYC_7)-PGKpuroBFP-W
Plasmid#211971PurposeExpress gRNA against MYC with puro and BFPDepositorInsertsgRNA targeting MYC (MYC Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NANOG_g1)-PGKpuroBFP-W
Plasmid#211974PurposeExpress gRNA against NANOG with puro and BFPDepositorInsertsgRNA targeting NANOG (NANOG Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NANOG_g2)-PGKpuroBFP-W
Plasmid#211975PurposeExpress gRNA against NANOG with puro and BFPDepositorInsertsgRNA targeting NANOG (NANOG Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETS2_5-5)-PGKpuroBFP-W
Plasmid#211959PurposeExpress gRNA against ETS2 with puro and BFPDepositorInsertsgRNA targeting ETS2 (ETS2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(FOXH1_5-2)-PGKpuroBFP-W
Plasmid#211962PurposeExpress gRNA against FOXH1 with puro and BFPDepositorInsertsgRNA targeting FOXH1 (FOXH1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(FOXH1_5-4)-PGKpuroBFP-W
Plasmid#211963PurposeExpress gRNA against FOXH1 with puro and BFPDepositorInsertsgRNA targeting FOXH1 (FOXH1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ID1_5-2)-PGKpuroBFP-W
Plasmid#211964PurposeExpress gRNA against ID1 with puro and BFPDepositorInsertsgRNA targeting ID1 (ID1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ID1_5-5)-PGKpuroBFP-W
Plasmid#211965PurposeExpress gRNA against ID1 with puro and BFPDepositorInsertsgRNA targeting ID1 (ID1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETS2_5-2)-PGKpuroBFP-W
Plasmid#211958PurposeExpress gRNA against ETS2 with puro and BFPDepositorInsertsgRNA targeting ETS2 (ETS2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-3g-EEA-2g-PGK-Puro
Plasmid#201677PurposeEBNA episome plasmid for U6 promoter-driven expression of 3 gRNAs targeting miRNA302/367 (Addgene #201960) and 2 gRNAs targeting EEA-motif (Addgene #102898). Includes PGK-puro selection cassetteDepositorInsertMIR302-3g-EEA-2g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA Td2
Plasmid#176261PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA E4-En-1 (GB2243)
Plasmid#160565PurposetRNA and scaffold for the assembly of GBoligomers for the position [4_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInserttRNA-gRNA position E4-En-1 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gKAT6A-A8)-PGKpuro2ABFP-W
Plasmid#159290PurposeLentiviral vector expressing gRNA targeting KAT6A (gRNA ID. A8)DepositorInsertguide RNA targeting KAT6A (ID. A8) (KAT6A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6 promoterAvailable SinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gKAT6A-A7)-PGKpuro2ABFP-W
Plasmid#159289PurposeLentiviral vector expressing gRNA targeting KAT6A (gRNA ID. A7)DepositorInsertguide RNA targeting KAT6A (ID. A7) (KAT6A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6 promoterAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCC_11 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-KRAB-dxCas9-NLS-2A-Puro-WPRE
Plasmid#139096PurposeExpresses human codon-optimized inactive xCas9 3.7 fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dxCas9 3.7
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, A262T, R324L,S409I, E480K, E543D, M6…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYJA5
Plasmid#217778PurposeThe empty vector for quadruple sgRNA cloningDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsPuromycin resistance gene, T2A, and TagBFPExpressionMammalianPromoterPGK, CMV, U6Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-vioABE-4A6-vioC-3A2-vioD
Plasmid#73440PurposeViolacein pathway (vioABECD) in monocistronic configuration, transcriptionally driven by orthogonal T7-lac promoter variants G6 (vioABE), 4A6 (vioC), and 3A2 (vioD) for orthogonal flux redirection.DepositorInsertPG6-vioABE-P4A6-vioC-P3A2-vioD
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPG6, P4A6, and P3A2 (orthogonal T7-lac variants)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
hu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmid
Plasmid#154429Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmidDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmid
UseCRISPR and LentiviralExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY0181 Cargo EGFP with AttP Bxb1 site (Parent minicircle)
Plasmid#179115PurposeCargo EGFP with AttP Bxb1 site (Parent minicircle)DepositorInsertCargo EGFP with AttP Bxb1 site
UseCRISPRAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDY0423 Cargo EGFP with AttP Bxb1 site for in-frame fusion (Parent minicircle)
Plasmid#179116PurposeCargo EGFP with AttP Bxb1 site for in-frame fusion (Parent minicircle)DepositorInsertCargo EGFP with AttP Bxb1 site for in-frame fusion
UseCRISPRAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only