We narrowed to 1,610 results for: ICL
-
Plasmid#179723PurposeLentiviral expression of lysosome-targeted Halo tagged mouse Syt7DepositorInsertSYT7 (Syt7 Mouse)
UseLentiviralAvailabilityAcademic Institutions and Nonprofits only -
pF(UG) U6-SYT7 sgRNA 777 HaloTag
Plasmid#179724PurposeU6-driven SYT7 gRNA and HaloTag lentiviral vector for CRISPR/HITIDepositorInsertsgRNA and HaloTag
UseLentiviralAvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2B V304A,I367A IRES GFP
Plasmid#133821PurposeEncodes the C2B domain of synaptotagmin 1 with membrane-penetrating residue mutations V304A,I367A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationV304A, I367APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2B D363,365N IRES GFP
Plasmid#133822PurposeEncodes the C2B domain of synaptotagmin 1 with calcium-coordinating ligand mutations D363,365N for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationD363,365NPromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2A K189-192A IRES GFP
Plasmid#133823PurposeEncodes the C2A domain of synaptotagmin 1 with poly-lysine patch mutations K189-192A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationK189-192APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2A D230,232N IRES GFP
Plasmid#133824PurposeEncodes the C2A domain of synaptotagmin 1 with calcium-coordinating ligand mutations D230,232N for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationD230,232NPromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2A M173,F234A IRES GFP
Plasmid#133825PurposeEncodes the C2A domain of synaptotagmin 1 with membrane-penetrating residue mutations M173,F234A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationM173, F234APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn NS34a-msGFP-'S-mito
Plasmid#158768PurposeLentiviral expression of self-cleaving membrane targeting peptide containing the OMP25 C-terminal targeting sequence, the P6P4 NS5A/5B cleavage site, msGFP and the NS3/4A protease.DepositorInsertNS3/4a protease and msGFP
UseLentiviralMutationFlexible linkers between the protease and msGFP a…AvailabilityAcademic Institutions and Nonprofits only -
eGFP-KIF5A
Plasmid#172201PurposeExpresses KIF5A tagged with eGFP in mammalian cellsDepositorAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1365 LV EF1a-CD28 IRES-EGFP
Plasmid#201921Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD28DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1363 LV EF1a-CD19 IRES-EGFP
Plasmid#201919Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD19DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBa.TfR-Halo
Plasmid#162716PurposeMammalian expression of human TFRCDepositorInsertTfR (TFRC Human) (TFRC Human)
TagsHaloExpressionMammalianMutationnonePromoterChicken Beta actinAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Mm-PylRS-AF/Pyl-tRNACUA
Plasmid#122650PurposetRNA synthetase/tRNA pair for the incorporation of unnatural amino acid into proteins in mammalian cells in response to the amber codon TAG.DepositorInsertPylRS-AF, Pyl-tRNACUA
TagsFLAGExpressionMammalianMutationTyrosine 306 changed to Alanine, Tyrosine 384 cha…Available SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-n1-APP
Plasmid#69924Purposemammalian expression of human APP fused to EGFPDepositorAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
FRB-mCherry-Giantin
Plasmid#186575PurposeExpression of FRB-mCherry on Golgi membrane with Giantin transmembrane (residues 3131-3259)DepositorAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-Tetherin
Plasmid#41070DepositorAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMEH343 CD63 MS2 HA
Plasmid#168217PurposeMammalian expression of tetraspanin CD63 fused to the MS2 dimer and C-terminal HA tagDepositorAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lamp1-mCherry-FRB
Plasmid#186576PurposeExpression of mCherry-FRB at the outer surface of the lysosome using LAMP1DepositorAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
σ2-mCherry
Plasmid#186579PurposeExpression of adaptor protein 2 (AP2) sigma subunit AP2S1 tagged with mCherryDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Myc-Parkin
Plasmid#17612DepositorAvailable SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
PB-Ef1a-PP7 coat protein-Halo-GB1x3-WPRE
Plasmid#198337PurposePB plasmid expressing Halo-tagged PP7 coat proteinDepositorInsertPP7 coat protein 3x Halo-GB1
UsePiggybacTagsHaloTagExpressionMammalianPromoterEf1aAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1364 LV EF1a-CD4 IRES-EGFP
Plasmid#201920Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD4DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
gWiz_BM40-vGAT-VH-hIgG1-CH1-TS-HIS
Plasmid#218436Purposemammalian expression plasmid for the heavy chain fragment of an anti-vGAT Fab domainDepositorInsertvGAT-Vh-hIgG1-CH1
UseAffinity Reagent/ AntibodyTagsBM40 and TwinStrep-6xHisExpressionMammalianPromoterCMVAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-Synectin
Plasmid#35791DepositorAvailable SinceJune 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pST39-pNL29
Plasmid#91696PurposeExpresses Mega GVs in E.ColiDepositorInsertMega GV gene cluster (from pNL29) in pST39 backbone
TagsNo tagsExpressionBacterialPromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX-LC3-YFP
Plasmid#99571PurposeLentiviral expression of YFP-tagged LC3DepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEH31 Lamp2b HA
Plasmid#168208PurposeMammalian expression of lysosome-associated membrane protein 2b fused to a C-terminal HA tagDepositorAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-CD63-FKBP-Myc
Plasmid#177910Purposehuman CD63-FKBP-Myc tagDepositorAvailable SinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
HC078 (3xHA-Atg13)
Plasmid#59544PurposeExpresses yeast Atg13 under the endogenous promoter with a 3xHA N-terminal tagDepositorInsertATG13 (ATG13 Budding Yeast)
Tags3xHAExpressionBacterial and YeastMutationAvrII site created after start codonPromoterATG13Available SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
His-GFP-Clathrin
Plasmid#170858PurposeMammalian expression of His-GFP-Clathrin.DepositorInsertClathrin light polypeptide (Lca) (Clta Mouse)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCRISPR-CMV-cGAS3
Plasmid#102610PurposeCRISPR/Cas9 lentivector targeting human cGASDepositorInsertgRNA targeting human cGAS
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXL001-TQM IL13 CAR
Plasmid#154054PurposeLentiviral expression of TQM IL13 CAR for CAR-T therapyDepositorInsertTQM IL13 CAR
UseLentiviralPromoterEF1aAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-ABE-3'UTR-sgRNA-2xMS2
Plasmid#132554PurposeVector plasmid expressing ABEmax and sgRNA scaffold with MS2 replacing the Tetraloop and loop 2DepositorInsertsABEmax
sgRNA, with Tetraloop and loop 2 replaced by MS2 aptamer
ExpressionMammalianAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
HA-mDyn1 pcDNA3
Plasmid#36263DepositorAvailable SinceApril 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pBa. BDNF-Halo
Plasmid#162718PurposeMammalian expression of rat BDNFDepositorInsertBrain derived neurotrophic factor (Bdnf Rat)
TagsHaloExpressionMammalianMutationnonePromoterChicken Beta actinAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-CBh-eGFP
Plasmid#206885Purposecloning backbone for sgRNA using OptScf2DepositorTypeEmpty backbonePromoterU6Available SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HiBiT-CD9
Plasmid#162592PurposeN-terminally HiBiT-tagged human CD9 under CAG promoterDepositorAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFsynW SYP-GFP
Plasmid#197283PurposeEncodes for viral expression of full-length wild type synaptophysin (SYP). Visualized by a C-terminal GFP.DepositorInsertSYP and GFP (Syp Rat)
UseLentiviralTags1D4 epitopeMutationN/APromoterhSyn (human synapsin I promoter)Available SinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only