We narrowed to 1,458 results for: U6 promoter
-
Plasmid#49408Purposeexpression of gRNA under control of the Drosophila U6:1 promoterDepositorInsertdU6-1:gRNA
UseCRISPRTagsExpressionInsectMutationPromoterdU6-1Available SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRTagsExpressionMutationPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330-NEAT1pr_v1
Plasmid#97081PurposeEncodes an sgRNA that creates a DSB at the promoter of human NEAT1 geneDepositorInsertsgRNA NEAT1pr_v1
UseCRISPRTagsExpressionMutationPromoterU6Available SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-NEAT1pr_v2
Plasmid#97082PurposeEncodes an sgRNA that creates a DSB at the promoter of human NEAT1 geneDepositorInsertsgRNA NEAT1pr_v2
UseCRISPRTagsExpressionMutationPromoterU6Available SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-GFP-SFPQ
Plasmid#97084PurposeEncodes an sgRNA that creates a DSB at the promoter of human SFPQ gene.DepositorInsertsgRNA GFP-SFPQ
UseCRISPRTagsExpressionMutationPromoterU6Available SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
OA-1050G (white)
Plasmid#132420Purposeexpress arrays of gRNA targeting White under dU6-3 promoterDepositorInsertwhite gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050J (GFP)
Plasmid#133304Purposeexpress arrays of gRNA targeting GFP under dU6-3 promoterDepositorInsertGFP gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF824_U6-Sau-sgRNA-EF1a-mCherry2_lenti
Plasmid#138318PurposeLenti expression of mCherry2 with U6 promoter for SauCas9 sgRNA targeting GFPDepositorInsertSauCas9 GFP sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF820_U6-sgRNA-EF1a-mCherry2_lenti
Plasmid#138316PurposeLenti expression of mCherry2 with U6 promoter for SpyCas9 sgRNA targeting GFPDepositorInsertSpyCas9 GFP sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050I (notch)
Plasmid#132421Purposeexpress arrays of gRNA targeting Notch under dU6-3 promoterDepositorInsertnotch gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050K (firefly luciferase)
Plasmid#132422Purposeexpress arrays of gRNA targeting Firefly Luciferase under dU6-3 promoterDepositorInsertfirefly Luciferase gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050V (wingless)
Plasmid#132424Purposeexpress arrays of gRNA targeting Wingless under dU6-3 promoterDepositorInsertwingless gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050Z4 (yellow)
Plasmid#132425Purposeexpress arrays of gRNA targeting Yellow under dU6-3 promoterDepositorInsertyellow gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cdk12_intron3_sg2_pX330
Plasmid#127174PurposesgRNA that cuts within intron 3 of mouse Cdk12 genomic locus in pX330 backboneDepositorInsertMouse Cdk12 Intron 3 sgRNA
UseCRISPR and Mouse TargetingTagsExpressionMutationPromoterU6 PromoterAvailable SinceAvailabilityAcademic Institutions and Nonprofits only -
Cdk12_intron4_sg1_pX458
Plasmid#127175PurposesgRNA that cuts within intron 4 of mouse CDK12 genomic locus in pX458 backboneDepositorInsertMouse Cdk12 Intron 4 sgRNA
UseCRISPR and Mouse TargetingTagsExpressionMutationPromoterU6 PromoterAvailable SinceAvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3+1T>A_(PP7-C4-Q1)
Plasmid#232437PurposepegRNA with optimized 3' modifications to facilitate a +1 T to A prime edit in the HEK3 locusDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRTagsExpressionMutationPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-mU6gRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#72667PurposeLentiviral dual CRISPR gRNA expression vector (mouse U6 and human U6 promoters)DepositorInsertmU6gRNA cassette, hU6gRNA cassette, PGKpuroBFP cassette, WPRE
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6_B2M_sgRNA(PP7)
Plasmid#232438PurposesgRNA to facilitate a splice donor site disruption via adenine base editing in the B2M locus, contains a PP7 aptamer in the scaffold tetraloopDepositorInsertPP7-tagged gRNA for B2M disruption via splice donor consensus disruption via ABE8e or Cas9 driven by human U6 promoter
UseCRISPRTagsExpressionMutationPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-dTomato
Plasmid#99376PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A dTomato from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-dTomato
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-mTagBFP2
Plasmid#99374PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A mTagBFP2 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-mTagBFP2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-dCas9-VPR-pA-3xsgRNA-EF1a-Tet.O-T2A-PuroR-polyA
Plasmid#166693PurposeExpress dCas9-VPR in a doxycyclin-inducable system and 3 sgRNAs targeting the murine Cnga1 promoter. Can be stably integrated into the genome via the PiggyBac Transposon system.DepositorInsertsdCas9-VPR
3x Cnga1 promoter-targeting sgRNAs
UseCRISPRTagsExpressionMammalianMutationPromoterTRE and U6Available SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-eGFP
Plasmid#99375PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A eGFP from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-eGFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-iRFP670
Plasmid#99377PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A iRFP670 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-iRFP670
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pED9x (dCas9-KRAB-mCherry)
Plasmid#163956PurposeLentiviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoter for crRNA expression and EFS promoter…Available SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Crimson
Plasmid#70683PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and Crimson reporter from EF-1a promoter. Lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Crimson Reporter
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEf1-a and hU6Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI)
Plasmid#64217PurposeExpression vector for sgRNAs cloned into the BbsI sites, shRNAs into BamHI & AflII and for Expression of Cas9 linked to mCherry via T2ADepositorInsertsCas9
hU6 promoter; BbsI sites for sgRNA
H1 promoter; BamHI site for shRNA
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianMutationPromoterCBh, H1, and U6Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ96 AAV-SpABE8e-N-terminus_tracrRNA
Plasmid#211817PurposeAAV vector expressing N-terminal of SpCas9-ABE8e and tracrRNADepositorInsertN-terminus of SpCas9-ABE8e and tracrRNA
UseAAVTagsExpressionMammalianMutationPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ100 AAV-SpABE8e-C_terminus-tracrRNA
Plasmid#211818PurposeAAV vector expressing C-terminus of SpCas9-ABE8e with tracrRNADepositorInsertC-terminus of SpCas9-ABE8e and tracrRNA
UseAAVTagsExpressionMammalianMutationPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaActin binding domain
Plasmid#187276PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Actin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryExpressionMutationdeltaActin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaMyosin binding domain
Plasmid#187275PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Myosin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryExpressionMutationdeltaMyosin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
px330-CIB1-dCas9
Plasmid#63665PurposeMammalian gRNA expression vector also expressing CIB1-dCas9DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterU6 and CMVAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR2
Plasmid#167001PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorInsertAR Promoter sgRNA 2 (AR Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorInsertAR Promoter sgRNA 1 (AR Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR3
Plasmid#167002PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorInsertAR Promoter sgRNA 3 (AR Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico shMAPKAPK3 human
Plasmid#85661Purposeexpression of shRNA targeting human MAPKAPK3DepositorInsertMAPKAPK3 (MAPKAPK3 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6Available SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryExpressionMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR10
Plasmid#167003PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorInsertAR Promoter sgRNA 10 (AR Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 T2 CRIPR in pX330
Plasmid#72833PurposeCRISPR/Cas to target the AAVS1 locus in human cellsDepositorInsertCas9 and gRNA for targeting the AAVS1 locus in human cells
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promoterAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ccas9LacZ
Plasmid#113083PurposeEnhanced C. elegans Cas9 vector. Ccas9LacZ contains a lacZ coding sequence, two Cas9 and two type-IIs restriction enzyme recognition sites next to the U6 promoter and gRNA sequences.DepositorTypeEmpty backboneUseCRISPRTagsExpressionWormMutationPromoterAvailable SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only